We narrowed to 1,691 results for: CAG promoter
-
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only