173,520 results

#157686

mammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp5 under control of a tetracycline-inducible promoter

David Tollervey

Bresson et al Wellcome Open Res. 2020 Nov 3;5:261. doi

Aug. 5, 2020

Industry, Academic Institutions, and Nonprofits

#156452

Targeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTG

Elphege Nora

Liu et al Nat Genet. 2021 Jan;53(1):100-109. doi:

Sept. 2, 2020

Academic Institutions and Nonprofits only

#202684

fluorescent protein tagged ezrin

Gerry Hammond

Pacheco et al J Cell Biol. 2023 Feb 6;222(2):e20220409

June 23, 2023

Academic Institutions and Nonprofits only

#136815

Mammalian expression of the centrosomal protein CENPJ N-terminally fused to SNAP-tag

Kai Johnsson

Lukinavicius et al Curr Biol. 2013 Feb 4;23(3):265-70. doi:

March 26, 2020

Academic Institutions and Nonprofits only

#167946

Fluorescent biosensor for extracellular L-lactate

Robert Campbell

Nasu et al Nat Commun. 2021 Dec 6;12(1):7058. doi:

April 22, 2021

Academic Institutions and Nonprofits only

#237034

Express Max-SmBiT Fusion Protein in Mammalian Cells under a CMV promoter

Promega Corporation

July 14, 2025

Industry, Academic Institutions, and Nonprofits

#181799

MCP-M-MLV-RT (MS2-N55K-MMLVRT)

Erik Sontheimer

Liu et al Nat Biotechnol. 2022 Apr 4. pii: 10.1038

April 4, 2022

Academic Institutions and Nonprofits only

#116818

Lentiviral expression of FGFR3__TACC3 fusion

Gordon Mills, Kenneth Scott

Ng et al Cancer Cell. 2018 Mar 12;33(3):450-462.e

March 14, 2019

Academic Institutions and Nonprofits only

#196036

The template UPEC vector designed for cloning of a single pegRNA and subsequent co-expression with Cre.

Tyler Jacks

Ely et al Nat Biotechnol. 2023 May 11. doi: 10.103

June 30, 2023

Academic Institutions and Nonprofits only