We narrowed to 15,903 results for: grna
-
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgGAA
Plasmid#232724PurposeCas9 guide RNA targeting GAA repeats for A-to-G base editingDepositorInsertSpCas9 gRNA targeting GAA repeats
ExpressionMammalianAvailable sinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA1
Plasmid#180374Purposetargeting mouse Arkadia geneDepositorAvailable sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GSG1l-GFP KI
Plasmid#131492PurposeEndogenous tagging of GSG1-l: C-terminal (amino acid position: STOP codon)DepositorAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-EFS-SaABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189922PurposeAAV genome encoding SaABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e
UseAAVMutationSaCas9 D10APromoterEFSAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR)
Plasmid#71485PurposeBase plasmid for sgRNA cloning with Hygromycin resistance and Tol2 transposon armsDepositorTypeEmpty backbonePromoterU6Available sinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMOD_B2403
Plasmid#91071PurposeModule B, Promoter: CmYLCV, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with ribozyme spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with ribozyme spacers
UseCRISPRPromoterCmYLCVAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTW2278
Plasmid#252579PurposeTRV2 multiplex vector expressing wild type Ymu1, AtCHLl1 gRNA4 and AtPDS3 gRNA12DepositorInsertYmu1 with AtCHLl1 gRNA 4 and AtPDS3 gRNA12
UseCRISPRExpressionPlantAvailable sinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgUBR4
Plasmid#202442PurposeExpression of a guide RNA targeting UBR4DepositorAvailable sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1085L
Plasmid#191376PurposepBac-U6-crGFP-array-UTR-opie2-eGFP-3xp3-tdTomatoDepositorInsert4 gRNAs targeting GFP
ExpressionInsectAvailable sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Nectin-2
Plasmid#170295PurposeA knock-out vector for the mouse Nectin-2DepositorInsertA gRNA targeting the mouse Nectin-2 gene.
UseCRISPR and LentiviralAvailable sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Necl-5
Plasmid#170294PurposeA knock-out vector for the mouse Necl-5DepositorInsertA gRNA targeting the mouse Necl-5 gene.
UseCRISPR and LentiviralAvailable sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
OpenCRISPR-1 sgRNA-12nt stem
Plasmid#221567PurposeExpress OpenCRISPR-1 sgRNA (12nt stem loop) in human cells using a U6 promoter. Plasmid also encodes a CMV-driven GFP reporter.DepositorInsertOpenCRISPR-1 sgRNA 12nt stem loop
ExpressionMammalianPromoterU6Available sinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorPublicationAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-tmpknot-epegRNA-puro backbone
Plasmid#214089PurposeLentiviral backbone plasmid to insert epegRNAs (mpknot) of interest. The cloning site is BsmbI.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6, EF1aAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only