We narrowed to 165,652 results for: addgene
-
Plasmid#244276Purpose5' AAVLINK plasmid for KDM3B expressionDepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pAAVLINK-EF1alpha-HA-5'-ARHGAP5
Plasmid#244322Purpose5' AAVLINK plasmid for ARHGAP5 expressionDepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-term AAV-ABE8e-SpCas9(S55R) (CA21)
Plasmid#242659PurposeCBh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-SpCas9(S55R) - to be used with eVRQR constructsDepositorInsertpAAV-pCBh-BPNLS(SV40)-TadA8e-gs-SpCas9(D10A;S55R)-[N-term]-NpuN-BPNLS(SV40)-WPRE-bGH_PA
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationSpCas9(S55R)PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINK-EF1alpha-HA-5'-RERE
Plasmid#244262Purpose5' AAVLINK plasmid for RERE expressionDepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJP_Bla01
Plasmid#230982PurposeModified version of the pBLADE_ONLY_C (#168050). It expresses VVD-AraC, but the f1 ori was deleted and the chloramphenicol resistance gene was replaced by gentamicin resistance.DepositorInsertGentamicin resistance gene
ExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CNTL-sfGFP
Plasmid#240100PurposeSP6-GFP plasmidDepositorInsertsfGFP
ExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-EF1alpha-5' KDM5B
Plasmid#236648Purpose5' AAVLINK plasmid for KDM5B expressionDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-pCALM1-Cre-3' KDM5C
Plasmid#236671Purpose3' AAVLINK plasmid for KDM5C expressionDepositorAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-pCALM1-Cre-3' KDM5B
Plasmid#236649Purpose3' AAVLINK plasmid for KDM5B expressionDepositorAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-pCALM1-Cre-3' KDM5A
Plasmid#236711Purpose3' AAVLINK plasmid for KDM5A expressionDepositorAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E3GFP
Plasmid#233008PurposeGalactose iduced expression of Gcn4 E+GFP in yeastDepositorInsertGcn4 E+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 F124IHA
Plasmid#232993PurposeGalactose iduced expression of Gcn4 F124IHA in yeastDepositorInsertGcn4 F124I
Tags3xHA and TEV cleavage siteExpressionYeastMutationF124IPromoterGal1Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WTSLFD
Plasmid#232980PurposeGalactose iduced expression of Gcn4 WTSLFD+ in yeastDepositorInsertGcn4 WTSLFD+
Tags3xHA and TEV cleavage siteExpressionYeastMutationF108W, E109T, Y110S, E111L, N112F, L113DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro2+
Plasmid#232982PurposeGalactose iduced expression of Gcn4 Aro2+ in yeastDepositorInsertGcn4 Aro2+
TagsTEV cleavage siteExpressionYeastMutationN116F, S117E, E119N, P129Q, T132YPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only