We narrowed to 22,708 results for: TES
-
Plasmid#138578PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17898458_17899478DepositorAvailable SinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.24-Cd36-enhancer3
Plasmid#138575PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17848003_17849903DepositorAvailable SinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer2
Plasmid#138574PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17843052_17844983DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry PGK-1 in pcDNA3.1
Plasmid#64214PurposemCherry fused between Cry2 and PGK-1 to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
PGEX-6P1-hNF2-AR mutant
Plasmid#107149Purposebacterial expressionDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETM33_CEP55_EABR
Plasmid#178469PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRVdGL-1EGFP
Plasmid#98036PurposeSecond-generation rabies viral vector genomeDepositorInsertEGFP
ExpressionMammalianPromoterCMVAvailable SinceMarch 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dSAP
Plasmid#68830PurposeExpresses c-myc-tagged human RAD18 deleting SAP domainDepositorInsertc-myc tagged human RAD18 deleting SAP domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-1: shALAS-1
Plasmid#22750DepositorAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only