We narrowed to 15,273 results for: grn
-
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND1 targeting gRNA
Plasmid#215153PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCherry U6-sgRNA (BsmBI)
Plasmid#214128PurposeMammalian continuous expressionDepositorInsertsgRNA
UseLentiviralExpressionMammalianMutationWTAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-POLQ-Halo
Plasmid#211636PurposesgRNA against POLQDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA POLQ
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-CjCas9-MS2gRNA-Backbone
Plasmid#210711PurposeThis plasmid express MS2 loop containing Cj Cas9 gRNADepositorInsertMS2 loop containing Cj Cas9 gRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrV_oxTi365.gRNA
Plasmid#194052PurposesgRNA targeting ChrV_oxTi365 locus of the C. elegans genomeDepositorInsertChrV_oxTi365 sgRNA
ExpressionWormPromoterU6Available sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertECT2 sgRNA spacer (ECT2 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-deGFP
Plasmid#184840PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the mRNA of deGFP and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the the mRNA of deGFP, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9336 (pgRNA_II-1_NatMX)
Plasmid#161589PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site II-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA1
Plasmid#180374Purposetargeting mouse Arkadia geneDepositorAvailable sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA2
Plasmid#180369Purposetargeting mouse Ski geneDepositorAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-xCas9-sgRNA
Plasmid#179579PurposeExpresses xCas9 and gRNA that targets ColE1 plasmids for curing.DepositorInsertxCas9
ExpressionBacterialAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcCAST-sgRNA_entry (CJT83)
Plasmid#181785PurposeExpresses AcCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
ExpressionBacterialPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-2x
Plasmid#164414PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-2xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0302_Cq-U6-1_2xBbsI_gRNA-Loop
Plasmid#169369PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0302_Cq-U6-1_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039653Available sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only