We narrowed to 10,492 results for: nar
-
Plasmid#232761PurposeExpresses dCas9-EGFPDepositorInsertdCas9-EGFP
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ezh2[FL]-dCas9
Plasmid#100086PurposeFull-length [FL] mouse Ezh2 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsert14056 (Ezh2 Mouse)
UseCRISPRTags3XFLag-NLS-Ezh2[FL]-dCas9-NLSExpressionMammalianMutationPromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
DNMT3A-dCas9
Plasmid#100090PurposeDNMT3A fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertDNMT3A (DNMT3A Human)
UseCRISPRTags3XFLag-NLS-DNMT3A-dCas9-NLSExpressionMammalianMutationincludes aa 602-912PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
G9A[SET]-dCas9
Plasmid#100089PurposeCatalytic domain [SET] of human G9A fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertG9A (EHMT2 Human)
UseCRISPRTags3XFLag-NLS-G9A[SET]-dCas9-NLSExpressionMammalianMutationG9A[SET] includes aa 829-1209PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICE-RNaseHI-D10R-E48R-NLS-mCherry
Plasmid#60367PurposePlasmid for expression of an inactive mutant of bacterial RNase HI tagged with NLS-mCherry that can be used to detect R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI-D10R-E48R
UseTagsNLS from SV40 T antigen and mCherryExpressionMammalianMutationD10R+E48R; catalyticaly inactivePromoterCMV-tetAvailable sinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FUS/TLS-FLAGC
Plasmid#60362PurposePlasmid for expression of FLAG-GFP tagged human FUS/TLS (C-terminal tag). Confers resistance to G418.DepositorInsertFUS (FUS Human)
UseTagsFLAG and GFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CuO-V5 CASC3 siRes1+2 f.l. WT
Plasmid#158540PurposeFor PiggyBac-mediated integration of V5-tagged siRNA-resistant full-length CASC3DepositorInsertCASC3; BTZ; MLN51 (CASC3 Human)
UseTagsV5ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP core
Plasmid#179543Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertS. Pyogenes dCas9 with c-terminal human CBP core (aa 1084-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL452-Sf3b1-K700E
Plasmid#90425Purposeselectable HDR vector to introduce K700E mutation within mus Sf3b1 gene (for use with sgSf3b1(T1) and pL452(hygro)-Sf3b1-K700K plasmids enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorTagsExpressionMutationPromoterAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HA-LMW-FGF2
Plasmid#157663PurposeExpresses FGF2 in mammalian cellDepositorInsertFibroblast growth factor 2 (FGF2 Human)
UseTagsHA tagExpressionMammalianMutationdeleted amino acid 1-134PromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Hygro
Plasmid#186671PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Hygromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Hygromycin (YTHDF2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Puro
Plasmid#186670PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Puromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Puromycin (YTHDF2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-BE4max
Plasmid#216729PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and nCas9 (Cas9 with D10A mutation) in mammalian cells.DepositorInsertAID-C12*-BE4max (AICDA Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-1-NONO(53-312)
Plasmid#135442PurposeExpresses NONO 53-312 in the second site; for co-expression with His-tagged proteinDepositorInsertNon-POU domain-containing octamer-binding protein (NONO Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHis-LMW_FGF2
Plasmid#157657PurposeExpresses FGF2 in E.coli cellDepositorInsertFibroblast growth factor 2 (FGF2 Human)
UseTagsHis tagExpressionBacterialMutationchanged Cystein 211,229 to serine, deleted amino …PromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pLVNP2.0-SpCas9
Plasmid#206880PurposeExpresses FLAG-tagged SpCas9 fused to the N-terminus of Gag/GagPol harbouring an intervening phospholipase C-δ1 pleckstrin homology (PH) domainDepositorInsertSpCas9 (cas9 )
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianMutationPromoterhSYN, U6Available sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVTagsExpressionMammalianMutationPromoterchicken β-actin promoter and U6 promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVTagsExpressionMammalianMutationPromoterchicken β-actin promoter and U6 promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-WT
Plasmid#141339PurposeLentiviral vector for expression of human NHEJ1-WT in mammalian cellsDepositorInsertNHEJ1 (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-FOG1[N+C]
Plasmid#100085PurposedCas9 fused to two FOG1 peptide [aa 1-45] , one at the N-terminus and one at the C-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertFOG1(aa 1-45) (ZFPM1 Human)
UseCRISPRTags3XFLag-NLS-FOG1-dCas9-FOG1-NLSExpressionMammalianMutationPromoterCMVAvailable sinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ezh2[SET]-dCas9
Plasmid#100087PurposeCatalytic domain [SET] of mouse Ezh2 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertEzh2[SET] (Ezh2 Mouse)
UseCRISPRTags3XFLag-NLS-Ezh2[SET]-dCas9-NLSExpressionMammalianMutationEzh2[SET] includes aa 482-746PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-tdTomato
Plasmid#62516PurposeExpresses tdTomato under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing proceduresDepositorInserttdTomato
UseAAV and Synthetic BiologyTagsExpressionMammalianMutationPromoterhUbCAvailable sinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-B/c-AtMIR173
Plasmid#137885PurposePlant expression vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor downstream 3'D1[+]. Contains AtMIR173 for syntasi expression in any plant species.DepositorInsertsAtTAS1c-D2-B/c
2x35S-AtMIR173-Tnos
UseTagsExpressionPlantMutationA. thaliana TAS1c precursor sequence including a …PromoterAvailable sinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-eGFP
Plasmid#62518PurposeExpresses GFP under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing procedures.DepositorInserteGFP
UseAAVTagsExpressionMammalianMutationPromoterhUbCAvailable sinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only