We narrowed to 83,420 results for: myc
-
Plasmid#71806PurposeGenerating transgenic flies for 4-hydroxytamoxifen-inducible DamIDDepositorInsertFL.hsp70P-Dam[4-HT-intein@L127C]-Myc[closed]
ExpressionInsectAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] G301A K302A-Myc
Plasmid#246383PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationTGGGATTGGTAAGACAACTAT to TGGGATTGCTGCGACAACTAT am…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
Plasmid#246382PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationCCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCC…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-puro_V5-LOV-Tb-myc-MIRO1-TM-KQR (OMM)
Plasmid#253797PurposeExpress V5-LOV-Turbo2-myc-Miro1-TM-KQR (OMM) under TRE3G (tetracycline inducible) promoterDepositorInsertV5-LOV-Tb-myc-Miro1-TM-KQR (OMM) (RHOT1 Human)
UseLentiviral; Tetracycline inducible promoterExpressionMammalianPromoterpTRE_tetracycline inducibleAvailable SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL2-WPRE-UbC-Emerald
Plasmid#225945PurposeLentiviral vector plasmid expressing human atlastin GTPase 2 (ATL2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
MYC-hTRAK1(S200A, S201A, S719A, T834A, S919A)
Plasmid#219574PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A, S719A, T834A, S919A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationS200A, S201A, S719A, T834A, S919A mutationsPromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-EF1A-XRCC1-Myc-3GS-TurboN
Plasmid#248160PurposeXRCC1 with split TurboID: NDepositorAvailable SinceJan. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-RNF146(100-182)-myc
Plasmid#196236PurposeRNF146(100-182) WWE domain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertRNF146(100-182) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianPromoterEF1AAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-myc
Plasmid#196237PurposeAf1521(K35E/Y145R) macrodomain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertAf1521(K35E/Y145R) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianMutationamino acid 35 lysine is replaced with glutamic ac…PromoterEF1AAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-RNF146(100-182)-myc
Plasmid#196240PurposeN-terminal GST fusion of RNF146(100-182) WWE domain with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of RNF146(100-182) with a TEV protease site between GST and RNF146(100-182) encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.3 C-MYC PDZD8(ΔPDZ 367-449aa)
Plasmid#227871PurposeUsed for transfection of cells for expression of C-MYC PDZD8 (with deletion of PDZ aa 367-449)DepositorAvailable SinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
(942) pAAV EF1a dCasphi-[myc-ZIM3-HA] U6-gStop
Plasmid#195624PurposepAAV EF1a plasmid for constitutive expression of dCasphi-ZIM3 CRISPRi constructDepositorInsertdCasphi
UseAAVTagsC-Myc (NLS), HA tag, and ZIM3ExpressionMammalianMutationP749A and P753APromoterEF1a (Mlu1/EcoR1)Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA-0248 EF1a_mRens-cageIL-2-c-myc_T2A_ERret-H2M-Renin_T2A-mCherry_Gen2
Plasmid#231208PurposeSingle transcript cageIL-2 (mRens) + ER-renin (H2M) (Lenti)DepositorInsertmRens-cageIL-2-c-myc_T2A_ERret-H2M-Renin_T2A-mCherry (IL2 Human)
UseLentiviralMutationL80F, R81D, L85V, I86V, I92FAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA-0251 CMVTO-c-myc-mono-hIL10 (R5A11M)-rens
Plasmid#231216Purposemyc-CleaveIL-10DepositorInsertc-myc-mono-hIL10 (R5A11M)-rens (IL10 Human)
ExpressionMammalianMutationN36I, N110I, K117N, F129LAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA244 CMVTO_ERret-H2M-Renin_T2A_mRens-cageIL-10-c-myc_T2A-mCherry
Plasmid#231205PurposeSingle transcript cageIL-10 (mRens) + ER-renin (H2M)DepositorInsertERret-H2M-Renin_T2A_mRens-cageIL-10-c-myc_T2A-mCherry (IL10 Human)
ExpressionMammalianMutationL147I, R148H, I203V, L290VAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC(Δ1-143)-GFP-IRES-mCherry (ΔTAD)
Plasmid#231233PurposeMYC stability reporter construct with deletion of the N-terminal region (residues 1-143) for transient expression in mammalian cellsDepositorInsertMYC (MYC Human)
ExpressionMammalianMutationTAD deleted (delta1-143); numbering based on sequ…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL3-WPRE-UbC-Emerald
Plasmid#225946PurposeLentiviral vector plasmid expressing human atlastin GTPase 3 (ATL3) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM1-WPRE-UbC-Emerald
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM2-WPRE-UbC-Emerald
Plasmid#225940PurposeLentiviral vector plasmid expressing human stromal interaction molecule 2 (STIM2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL1-WPRE-UbC-Emerald
Plasmid#225944PurposeLentiviral vector plasmid expressing human atlastin GTPase 1 (ATL1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only