We narrowed to 2,521 results for: crispr system
-
Plasmid#123993PurposeEncodes the spCas9 sgRNA1 cROSA26 (homology arm 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA for cROSA Homology arm-2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_007
Plasmid#123994PurposeEncodes the spCas9 sgRNA1 cROSA26 (homology arm 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA for cROSA Homology arm-3
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_054
Plasmid#123959PurposeEncodes the saCas9 CXCR1 (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertCXCR4 sa sgRNA 3
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_056
Plasmid#123921PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (human u6 promoter and constant region 3) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-hu6_20N_cr3
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_028
Plasmid#123908PurposeEncodes the spCas9 sgRNA1 hThal5.10-2_hg18 (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA2 -hThal5.10-2_hg18
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_029
Plasmid#123909PurposeEncodes the spCas9 sgRNA1 hThal5.10-2_hg18 (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA3 -hThal5.10-2_hg18
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK3_018
Plasmid#123733PurposeEncodes rapamycin and tamoxifen activated split-dCAS9 (N-terminal) as a Type 3 part to be used in the MTK systemDepositorInsertspdCas9(1-204)-frb-D10A-ERT2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK3_019
Plasmid#123734PurposeEncodes tamoxifen activated split-dCAS9 (N-Terminal) as a Type 3 part to be used in the MTK systemDepositorInsertspdCas9(1-204)-ERT2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only