We narrowed to 173,764 results for: Gene
-
Plasmid#192734PurposeGateway entry vector encoding zebrafish cxadrDepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221-nrip1a
Plasmid#192731PurposeGateway entry vector encoding zebrafish nrip1aDepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRPF4.211.522.gst
Plasmid#137650PurposeExpresses N-terminal GST-(His)6-Thrombin cleavage site fusion of human gene or portion of gene in bacterial strains. pET based vector.DepositorAvailable SinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-erg
Plasmid#192728PurposeGateway entry vector encoding zebrafish ergDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HMGN1-SE
Plasmid#192720PurposeGateway entry vector encoding mutant HMGN1DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD4-mT2A-mutated_rpsL-BSD-F
Plasmid#182338PurposeTemplate plasmid for PCR amplification of initial recombineering cassetteDepositorInsertBSD
UseMouse Targeting; Flp / frtExpressionBacterialAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSMPUW_8.3_M4_CAMKIIA-gateway-V5-SV40-Zeo
Plasmid#128463Purposelentiviral destination vector with CAMKIIA promoter, C-terminal V5 tag, SV40 promoter, and Zeo Resistance geneDepositorInsertCAMKIIA promoter, C-terminal V5 tag, SV40 promoter, and Zeocin Resistance gene
UseLentiviralAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJK581
Plasmid#71695PurposeProduces Acetobacter aceti 1023 thioredoxin with a C-terminal His6 tag and Cys35>Ser mutant (AaTrxAH6-C35S)DepositorInsertthioredoxin
TagsHis6ExpressionBacterialMutationchanges cysteine-35 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK558
Plasmid#71704PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with Cys138>Ser mutant (AaTrxB1-C138S)DepositorInsertthioredoxin reductase 1
ExpressionBacterialMutationchanges cysteine-138 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2-udhA
Plasmid#65819PurposegltA-udhA targeting guide RNA array E. coli , Low Phosphate InductionDepositorInsertgltA2-udhA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-49: MYL2-mEGFP
Plasmid#114414PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL2, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL2 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
iChr2-Notch Mosaic (SO250)
Plasmid#99752PurposeSecond generation Rosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different chromatin localized fluorescent proteins and Notch signalling genesDepositorInsertHIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PGK1p-Csy4-pA (Construct 2)
Plasmid#55196PurposeExpresses Csy4 in Mammalian cells for site-specific RNA processingDepositorInsertCsy4/Cas6
UseSynthetic BiologyTags6xHISExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro-CAG-GCaMP6s
Plasmid#120896PurposeDonor plasmid targeting human AAVS1 safe harbor locus to generate GCaMP6s gene knockin. Contains two homologous arms flanking T2A-Puro resistance gene and CAG-driven GCaMP6s gene.DepositorInsertGCaMP6s
ExpressionMammalianPromoterCAGAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu_Cas9
Plasmid#216423PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter and the Cas9 nuclease for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
JD171
Plasmid#229483PurposeAdenoviral helper plasmid containing E2A, VA RNA I and L4-22k/33k genesDepositorInsertE2A, VA RNA I, L4-22k/33k
UseAAV and AdenoviralExpressionMammalianPromoterCMV (E2A), Ef1a (L4-22k/33k) and wt promoter (VA …Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYL156 (TRV RNA2)
Plasmid#148969PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)DepositorInsertModified TRV RNA2
UseT-dna vectorMutationsee comments section belowAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only