We narrowed to 4,991 results for: IRES

#107543

AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP

Hélène Marie

Pousinha et al Elife. 2017 Jul 6;6. doi: 10.7554/eLife.

May 1, 2018

Academic Institutions and Nonprofits only

#110390

γ-Retroviral transfer vector for expressing glutminase isoform KGA (wild type), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.

Sandra Martha Gomes Dias

Feb. 23, 2021

Academic Institutions and Nonprofits only

#183744

Expresses Ki67 (shuffled Nterm)-mNeonGreen

Daniel Gerlich

Cuylen et al Nature. 2016 Jun 29;535(7611):308-12. do

Sept. 14, 2022

Academic Institutions and Nonprofits only

#85748

Expresses mTagBFP2 only; used as a control

Erik Sontheimer

Pawluk et al Cell. 2016 Dec 15;167(7):1829-1838.e9. d

Jan. 25, 2017

Academic Institutions and Nonprofits only

#120706

Expresses MAPKAP1 Truncation-Flag-HA-6xHIS fusion protein in mammalian cells & for virus production

Paul Khavari

Kovalski et al Mol Cell. 2019 Jan 4. pii: S1097-2765(18

Jan. 30, 2019

Academic Institutions and Nonprofits only

#183377

Stable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transduction

Jonathan Kagan

Devant et al Sci Immunol. 2021 Aug 10;6(62). doi: 10.

May 5, 2022

Academic Institutions and Nonprofits only

#166952

Lentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoter

Rosalind Segal

Fukuda et al J Cell Biol. 2021 Jan 4;220(1). pii: 211

March 24, 2021

Academic Institutions and Nonprofits only

#133817

Encodes the C2B domain of synaptotagmin 1 for viral expression

Edwin Chapman

Courtney et al Nat Commun. 2019 Sep 9;10(1):4076. doi:

July 13, 2020

Academic Institutions and Nonprofits only

#183456

Replacement of endogenous rat PKA-RIIα subunits with wild-type RIIα

Matthew Gold

Church et al Elife. 2021 Oct 6;10. pii: 68164. doi: 1

June 21, 2022

Academic Institutions and Nonprofits only