We narrowed to 5,362 results for: pAAV
-
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1494 - pAAV CaMKII SERCaMP-No Tag
Plasmid#192601PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-fDIO-tdTomato-WPRE
Plasmid#187112PurposeFLP-dependent expression of tdTomato under EF1a promoterDepositorInserttdTomato
UseAAVAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-QPAS1-VP16
Plasmid#186187PurposeAAV vector packaging QPAS1-VP16, a component of optogenetic system for NIR light-controllable transcriptional activationDepositorInsertNLS-QPAS1-VP16
UseAAVPromoterCAGAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-mSNCA(1-95)
Plasmid#185716PurposeAAV expression of GFP and C-terminal truncated (1-95 amino acid) mouse α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-TeTLc-P2A-mCherry
Plasmid#178708PurposeAAV vector for Flp-dependent transgene expression of TeTLc-P2A-mCherry in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertTeTLc-P2A-mCherry
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hsChRmine-oScarlet-WPRE
Plasmid#183520PurposeOptogeneticsDepositorInserthsChRmine-oScarlet
UseAAVMutationH33RPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(HD)-Tet1S-NLS-SID4X_2A_EGFP_W3SL
Plasmid#172208PurposeAAV vector expressing an HA-tagged TALE-SID4X transcriptional repressor protein targeting the mouse Tet1S promoter. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(HD)-Tet1S-NLS-SID4X_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(NG)-Tet1FL-NLS-SID4X_2A_EGFP_W3SL
Plasmid#172205PurposeAAV vector expressing an HA-tagged TALE-SID4X transcriptional repressor protein targeting the mouse Tet1FL promoter. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(NG)-Tet1FL-SID4X-NLS_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChromeQ-GFP]
Plasmid#153542PurposeAAV-mediated expression of ChromeQ-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner.DepositorInsertChromeQ-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α1.1Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChromeT-GFP]
Plasmid#153541PurposeAAV-mediated expression of ChromeT-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner.DepositorInsertChromeT-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α1.1Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-GCaMP6f-4x128-mAGNET
Plasmid#166023PurposeExpresses GCaMP6f in CaMKII+ cells with low miRNA-128 expressionDepositorInsertGCaMP6f with 4 miR-128 binding sites
UseAAV and Mouse TargetingTagsNoneExpressionMammalianAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-mRuby2-4x128-mAGNET
Plasmid#166021PurposeExpresses mRuby in CaMKII+ cells with low miRNA-128 expressionDepositorInsertmRuby2 with 4 miR-128 binding sites
UseAAV and Mouse TargetingTagsNoneExpressionMammalianMutationNoneAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ChromeT-GFP]
Plasmid#153539PurposeAAV-mediated expression of ChromeT-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertChromeT-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgVamp1
Plasmid#159919PurposeMutagenesis of Vamp1DepositorInsertVamp1 (Vamp1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgNtn1
Plasmid#159907PurposeMutagenesis of Netrin1DepositorInsertNetrin1 (Ntn1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only