We narrowed to 643 results for: Adh1
-
Plasmid#177796PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[3]ExpressionYeastMutationPromoterADH1Available sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH742-CEN-RLuc/slowminCFLuc
Plasmid#38222DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGBKT7_AvrSr62-5
Plasmid#233532PurposeExpresses AvrSr62-5 in yeastDepositorInsertAvrSr62-5
UseTagsGAL4 BD, Myc tagExpressionYeastMutationPromoterADH1Available sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGBKT7_AvrSr62-1
Plasmid#233531PurposeExpresses AvrSr62-1 in yeastDepositorInsertAvrSr62-1
UseTagsGAL4 BD, Myc tagExpressionYeastMutationPromoterADH1Available sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGADT7_Sr62NLRa
Plasmid#233528PurposeExpresses Sr62NLRa in yeastDepositorInsertSr62NLRa
UseTagsGAL4 AD, HA tagExpressionYeastMutationPromoterADH1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWR63(YUM1)
Plasmid#203336Purposeepisomal Cas9 and YUM1-targeting sgRNA expression vector for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
YUM1-targeting sequence
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63
Plasmid#203331Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48) aa24-150-VSV
Plasmid#212747PurposeConstitutive expression of NUbo-E3(48)ΔU7BD-VSV in budding yeast, inactive E3(48)DepositorInsertE3(48) aa24-150
UseIntegrative vectorTagsNUbo and VSVExpressionYeastMutationCue1 ΔU7BDPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1)-CUbo-mCherry-VSV
Plasmid#212740PurposeConsitutive expression of myc-E3(1)-CUbo-mCherry-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-mCherry-VSV and mycExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-myc-E3(1)-CUbo-mCherry-VSV
Plasmid#212739PurposeConsitutive expression of myc-E3(1)-CUbo-mCherry-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-mCherry-VSV and mycExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1) C885A-CUbo-VSV
Plasmid#212738PurposeConsitutive expression of myc-E3(1) C885A-CUbo-VSV in budding yeast, catalytic inactive E3(1)DepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-NLS-VSV and mycExpressionYeastMutationHOIP(C885A)PromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-myc-E3(1)-CUbo-NLS-VSV
Plasmid#212737PurposeConsitutive expression of myc-E3(1)-CUbo-NLS-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-NLS-VSV and mycExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-FHIP
Plasmid#198527PurposeExpression of GAL4 DNA-binding domain (BD)-FHIP fusion protein in yeast (yeast two-hybrid assays)DepositorInsertFHIP (FHIP1B Human)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationsilent mutations in codons 353 and 651 as well as…PromoterADH1Available sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-ATG9A-N
Plasmid#198530PurposeExpression of GAL4 DNA-binding domain (BD)-ATG9A-N terminal cytosolic domain fusion protein in yeast (yeast two-hybrid assays)DepositorInsertATG9A N-terminal cytosolic tail (residues 1-66) (ATG9A Human)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationPromoterADH1Available sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-FTS
Plasmid#198526PurposeExpression of GAL4 DNA-binding domain (BD)-FTS fusion protein in yeast (yeast two-hybrid assays)DepositorInsertFTS (AKTIP Human)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationPromoterADH1Available sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-FHIP-L
Plasmid#198528PurposeExpression of GAL4 DNA-binding domain (BD)-FHIP-L fusion protein in yeast (yeast two-hybrid assays)DepositorInsertFHIP-L (FHIP1A Human)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationPromoterADH1Available sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook1
Plasmid#198523PurposeExpression of GAL4 DNA-binding domain (BD)-Hook1 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook1 (HOOK1 Human)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationsilent substitution in codon 620 to eliminate int…PromoterADH1Available sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-δ
Plasmid#197259PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-3 δ fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-3 δ (AP3D1 Human)
UseTagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationVal 549 Ile substitution; silent substitutions in…PromoterADH1Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ3A
Plasmid#197513PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-3 σ3A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-3 σ3A
UseTagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationsilent substitution in codon 2 of tyrosinase tail…PromoterADH1 and MET25Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-γ1
Plasmid#197078PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 γ1 fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-1 γ1 (Ap1g1 Mouse)
UseTagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationPromoterADH1Available sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-ε
Plasmid#197261PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-4 ε fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-4 ε (AP4E1 Human)
UseTagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationsilent substitutions in codons 905, 1129 and 1137PromoterADH1Available sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only