We narrowed to 308 results for: IPTG
-
Plasmid#141291PurposeMBP:NLUC:3xFlag:10xHis in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertMBP-NLUC3F10H
UseLuciferaseTagsFlag (x3), His (x10), and MBPExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQmod2E-GG
Plasmid#191345PurposeClostridium expression vector (pBP1 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod3E-GG
Plasmid#191348PurposeClostridium expression vector (pCB102 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod4E-GG
Plasmid#191351PurposeClostridium expression vector (pCD6 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196M wgMDH
Plasmid#204273PurposeBacterial expression of R196M wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR196MAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 D193E wgMDH
Plasmid#204269PurposeBacterial expression of D193E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationD193EAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a - SodA
Plasmid#89612PurposeExpresses recombinant 6HIS tagged T. cruzi superoxide dismutase A protein in E. coli upon IPTG inductionDepositorInsertSuperoxide dismutase A
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - APX
Plasmid#89618PurposeExpresses recombinant 6HIS tagged T. cruzi ascorbate-dependent tryparedoxin peroxidase protein in E. coli upon IPTG inductionDepositorInsertAscorbate dependent Tryparedoxin peroxidase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - CPX
Plasmid#89620Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi cytoplasmic tryparedoxin peroxidase protein in E. coli upon IPTG inductionDepositorInsertCytosolic Tryparedoxin peroxidase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - SodB
Plasmid#89613PurposeExpresses recombinant 6HIS tagged T. cruzi superoxide dismutase B protein in E. coli upon IPTG inductionDepositorInsertSuperoxide dismutase B
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NDH
Plasmid#89626PurposeExpresses recombinant 6HIS tagged T. cruzi NADP-dependent oxidoreductase in E. coli upon IPTG inductionDepositorInsertNAD(P)-dependent oxidoreductase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPH07
Plasmid#234345PurposeLibrary-scale IPTG-inducible gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertType II dCas9 sgRNA
UseCRISPRExpressionBacterialPromoterlacUV5Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPH021
Plasmid#234346PurposeLibrary-scale IPTG-inducible single transcript dual-gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertsType II dCas9 sgRNA
Type II dCas9 sgRNA
UseCRISPRExpressionBacterialPromoterlacUV5Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196E wgMDH
Plasmid#204272PurposeBacterial expression of R196E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR196EAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130Q wgMDH
Plasmid#204268PurposeBacterial expression of R130Q wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR130QAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 M66L wgMDH
Plasmid#204247PurposeBacterial expression of M66L wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationM66LAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 M91Q wgMDH
Plasmid#204250PurposeBacterial expression of M91Q wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationM91QAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 D87L wgMDH
Plasmid#204248PurposeBacterial expression of D87L wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationD87LAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQmod3S-GG
Plasmid#191349PurposeClostridium expression vector (pCB102 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only