We narrowed to 4,922 results for: FU
-
Plasmid#172346PurposeExpression of FLAG-tagged, codon-optimized, truncated SRSF3DepositorInsertserine and arginine rich splicing factor 3 (SRSF3 Human)
TagsFLAGExpressionMammalianMutationcodon-optimized, truncated at amino acid 114 with…PromoterEF-1aAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB.His.MBP.3C NLRP1 UPA-CARD WT
Plasmid#164003PurposeBacterial expression vector encoding a HRV 3C-cleavable His-MBP-tagged NLRP1 UPA-CARDDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLEX-rc [SomArchon-GFP]
Plasmid#153532PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α1.1Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-M85E-3XHA
Plasmid#242416PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a M85E mutation and a 3xHA tag.DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-V82E-3XHA
Plasmid#242393PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a V82E mutation and a 3xHA tag.DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-M92E-3XHA
Plasmid#242417PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a M92E mutation and a 3xHA tag.DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF1394
Plasmid#143104PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3134
Plasmid#144621PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3145
Plasmid#144609PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-3x-55-96
Plasmid#232015PurposeExpression of 3 tandem copies of CHMP2B helix 2, connected with gly-ser linkers, attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-201-213
Plasmid#232016PurposeExpression of the CHMP2B VPS4-binding region attached to sfGFP.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-SUMO-CHMP2B
Plasmid#232018PurposeBacterial expression of His and SUMO tagged CHMP2BDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B
Plasmid#232012PurposeExpression of FLAG-tagged CHMP2BDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3331
Plasmid#144807PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3324
Plasmid#144800PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only