We narrowed to 6,113 results for: tTA
-
Plasmid#117344PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR FAM102A-203
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-GRM4-202
Plasmid#117347PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR GRM4-202
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Epha3 in situ probe
Plasmid#45627DepositorInsertEpha3 in situ probe (Epha3 Mouse)
UseIn situMutationfragment contains bp# 3179-3773 of NM_010140Available SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAdEasy-EGFP-CLASP2 340-1362 9xS/A
Plasmid#24523DepositorInsertCLASP2 (340-1362) 9xS/A (CLASP2 Human)
UseAdenoviralTagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant. M…Available SinceJuly 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1 hSlp4-a V21A
Plasmid#40064DepositorInserthSlp4-a V21A (SYTL4 Human)
TagsGSTExpressionBacterialMutationValine 21 to AlaninePromoterTacAvailable SinceOct. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-n
Plasmid#53077Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET15-VraS - L114S/D242G
Plasmid#206873PurposeBacterial Expression of VraS double mutant L114S/D242GDepositorInsertVraS
Tags6x HisExpressionBacterialMutationL114S/D242GAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-EGFR-FCRL3-140aa-Chimera-puro
Plasmid#248151PurposeLentiviral vector encoding a chimeric protein composed of the transmembrane region of FCRL3 and its full-length cytoplasmic tail, fused to the extracellular domain of EGFR.DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-50aa-puro
Plasmid#248153PurposeLentiviral vector encoding a truncated form of human FCRL3, containing only the first 50 residues of the cytoplasmic tail.DepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralMutationMutagenesis to insert a stop codon at aa645 in FC…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-16aa-puro
Plasmid#248152PurposeLentiviral vector encoding a truncated form of human FCRL3, containing only the first 16 residues of the cytoplasmic tail.DepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralMutationMutagenesis to insert a stop codon at aa611 in FC…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-EGFR- FCRL3-50aa-Chimera-puro
Plasmid#248150PurposeLentiviral vector encoding a chimeric protein composed of the transmembrane region of FCRL3 and its truncated cytoplasmic tail (aa 595-644; first 50 residues), fused to the extracellular domain of EGFR.DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-93aa-puro
Plasmid#248154PurposeLentiviral vector encoding a truncated form of human FCRL3, containing only the first 93 residues of the cytoplasmic tail.DepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralMutationMutagenesis to insert a stop codon at aa688 in FC…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-EGFR-FCRL3-93aa-Chimera-puro
Plasmid#248149PurposeLentiviral vector encoding a chimeric protein composed of the transmembrane region of FCRL3 and its truncated cytoplasmic tail (aa 595-687; first 93 residues), fused to the extracellular domain of EGFR.DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP4 KD1 mScarlet
Plasmid#174407Purposelentiviral vector for VAMP4 knock-down in rat cells, KD1 shRNADepositorInsertvesicle associated membrane protein 4 (Vamp4 Rat)
UseLentiviralTagsmScarletExpressionMammalianPromoterH1-UbiquitinAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUS LC TtoS
Plasmid#226608PurposeAll threonines to serineDepositorInsertFUS LC 4QQ->GG (FUS Human)
Tags6HisExpressionBacterialMutation4 QQ pairs replaced with GG pairsPromoterT7Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUS LC QtoA
Plasmid#226609PurposeAll glutamines to alanineDepositorInsert6*His-TEV-FUS LC QtoA (FUS Human)
Tags6HisExpressionBacterialMutationAll glutamine to alaninePromoterT7Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUS LC 12S->G
Plasmid#226597Purpose12 serines to glycinesDepositorInsertFUS LC 12S->A (FUS Human)
Tags6HisExpressionBacterialMutation12 serines to alaninePromoterT7Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUS LC 12S->A
Plasmid#226598Purpose12 serines to alaninesDepositorInsertFUS LC 12S->A (FUS Human)
Tags6HisExpressionBacterialMutation12 serines to alaninePromoterT7Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only