We narrowed to 7,947 results for: AMPH

#70254

sacB plasmid with polylinker; chloramphenicol/erythromycin resistance: use as a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion seq.

Peter Wolk

Cai et al J Bacteriol. 1990 Jun;172(6):3138-45.

Nov. 17, 2015

Academic Institutions and Nonprofits only

#128809

Fluoride riboswitch-regulated sfGFP

Julius Lucks

Thavarajah et al ACS Synth Biol. 2019 Dec 12. doi: 10.102

Dec. 17, 2019

Academic Institutions and Nonprofits only

#107770

Expression of phage Che9c RecT for oligo-mediated recombineering in mycobacteria

Kenan Murphy

Murphy et al Methods Mol Biol. 2015;1285:177-99. doi:

May 15, 2018

Academic Institutions and Nonprofits only

#71321

Donor plasmid - chloramphenicol resistant donor cassette

Thomas Kuhlman

Tas et al PLoS One. 2015 Sep 2;10(9):e0136963. doi

Dec. 11, 2015

Academic Institutions and Nonprofits only

#114219

POC12355, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type p-a

Christopher A. O'Callaghan

Lin et al Nucleic Acids Res. 2018 Jul 9. pii: 5050

Feb. 15, 2019

Academic Institutions and Nonprofits only

#48654

Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#48653

Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#242453

Expresses the MBP-GFP-RGG fusion protein.

Benjamin Schuster

Kelley et al Proc Natl Acad Sci U S A. 2021 Dec 21;11

Sept. 5, 2025

Academic Institutions and Nonprofits only

#242454

Expresses the GST-GFP-RGG fusion protein.

Benjamin Schuster

Kelley et al Proc Natl Acad Sci U S A. 2021 Dec 21;11

Sept. 5, 2025

Academic Institutions and Nonprofits only

#238470

pMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approach

Christopher A. O'Callaghan

Flores-Fernandez et al Nucleic Acids Res. 2025 Jun 20;53(12):gk

July 24, 2025

Academic Institutions and Nonprofits only