We narrowed to 167,150 results for: Gene
-
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp1
Plasmid#238034PurposeEncodes sfGFPunder lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-CG10011_C
Plasmid#146027PurposeInsect Expression of CG10011-3UTRDepositorInsertCG10011-3UTR (CG10011 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-CG3077_A
Plasmid#145868PurposeInsect Expression of CG3077-3UTRDepositorInsertCG3077-3UTR (CG3077 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj20
Plasmid#173150PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj20 (si:ch211-113j13.2 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj12b
Plasmid#173142PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj12b (kcnj12b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj14
Plasmid#173144PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj14 (kcnj14 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj19a
Plasmid#173148PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19a (kcnj19a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj19b
Plasmid#173149PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19b (kcnj19b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj21
Plasmid#173151PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj21 (zgc:162160 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 endAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2a
Plasmid#173127PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2a (kcnj2a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2b
Plasmid#173128PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2b (kcnj2b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj3b
Plasmid#173130PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj3b (kcnj3b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj4
Plasmid#173131PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj4 (kcnj4 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj9
Plasmid#173135PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj9 (kcnj9 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10a
Plasmid#173137PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10a (kcnj10a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10b
Plasmid#173138PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10b (LOC100329607 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj11l
Plasmid#173140PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj11l (kcnj11l Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUS250
Plasmid#198322PurposeCumate-inducible gene expression in diverse gram negative bacteria. Features also include mobilisation via oriT, a gigantic multiple cloning site, and blue/white screening via amilCP chromoproteinDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromotercumate-inducibleAvailable SinceApril 12, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS26
Plasmid#32295DepositorTypeEmpty backboneUseBacterial gene additionExpressionBacterialPromoterrhaBAvailable SinceSept. 26, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
p(+)MV-NSE-FlagrP-3g_haP-F497A-3p
Plasmid#58799PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497A gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
TagsFlag and HaPromoterT7Available SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMG207
Plasmid#39273DepositorTypeEmpty backboneUseE coli gene targetingAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
p(+)MV-NSE-FlagrP-3g_haP-F497D-3p
Plasmid#58800PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497D gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
TagsFlag and HaPromoterT7Available SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOTag2T-crelox-PUR
Plasmid#24026DepositorTypeEmpty backboneUseCre/LoxAvailable SinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag2T-crelox-HYG
Plasmid#24025DepositorTypeEmpty backboneUseCre/LoxAvailable SinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag4H-crelox-HYG
Plasmid#24027DepositorTypeEmpty backboneUseCre/LoxTags3XHAAvailable SinceMay 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag4H-crelox-PUR
Plasmid#24028DepositorTypeEmpty backboneUseCre/LoxTags3XHAAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag43M-crelox-PUR
Plasmid#24032DepositorTypeEmpty backboneUseCre/LoxTags3XHAAvailable SinceJune 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag43M-crelox-HYG
Plasmid#24031DepositorTypeEmpty backboneUseCre/LoxTags3XMycAvailable SinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
pZA1pLtetO-GFP
Plasmid#78227Purposesynthetic gene circuitDepositorInsertsynthetic gene circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
XLone-BSD NFIL3 T2A Puro
Plasmid#140028PurposeTunable and temporal expression control of NFIL3 and puro resistant geneDepositorInsertNFIL3 (NFIL3 Synthetic, Human)
UseSynthetic BiologyTagspuromycinExpressionMammalianPromoterTRE3GAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK576
Plasmid#72527PurposeEncodes Acetobacter aceti 1023 formylglycinamidine ribonucleotide synthetase small subunit (AaPurS); hypothetical protein associated with purSyQL cluster (AaOrfY)DepositorInsertsformylglycinamidine ribonucleotide synthetase, small subunit
hypothetical protein in purSQL operon
UseGene synthesisMutationsynthetic genePromotern/aAvailable SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAD-LyseR (in lacZ deficient strain)
Plasmid#99245PurposeFor autolysate production in lacZ deficient (lac operon deletion) E. coli BL21-Gold-dLac (DE3) strain: constitutively expresses phage lambda endolysin (gene R)DepositorAvailable SinceOct. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRL WS1.6 WASp
Plasmid#36250DepositorAvailable SinceJuly 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-TEAD1
Plasmid#33109DepositorAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only