We narrowed to 4,079 results for: Gaa
-
Plasmid#125780Purposeconstitutive expression of a short-hairpin RNA targeting human RPS6 (RNAi positive control)DepositorInsertshRPS6 (RPS6 Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
gamma2 CR3m shRNA
Plasmid#120795PurposeNegative control shRNA for plasmid 120794: shRNA targeting the coding region of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
gamma2 UTR3m shRNA
Plasmid#120797PurposeNegative control shRNA for plasmid 120796: shRNA targeting the 3'-untranslated region (UTR) of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN084
Plasmid#91609PurposeExpress sgRNA targeting human FANCLDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN085
Plasmid#91610PurposeExpress sgRNA targeting human FANCLDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN091
Plasmid#91620PurposeExpress sgRNA targeting human GALNT10DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN160
Plasmid#91579PurposeExpress sgRNA targeting human CACNB2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN161
Plasmid#91580PurposeExpress sgRNA targeting human CACNB2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
shMyb-1
Plasmid#247030PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid ProgenitorsDepositorAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
p305N-30
Plasmid#246313PurposeEvaluation of PtU6.2c3 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2c3 promoter
UseCRISPRExpressionPlantMutationdeletion: -T (-29 from TSS) within TATAPromoterPtU6.2c3 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shOGDH #2
Plasmid#242705PurposeshRNA knockdown human OGDH geneDepositorInsertOGDH (OGDH Human)
UseLentiviralAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shOGDH #1
Plasmid#242704PurposeshRNA knockdown human OGDH geneDepositorInsertOGDH (OGDH Human)
UseLentiviralAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ15-PB-U6-Nkx6.1-acti-gRNA1
Plasmid#131059PurposeActivation of NKX6.1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ05-Guide-SOX17-E2-gRNA2
Plasmid#131050PurposeSOX17 Knock outDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ07-CRISPR-SOX17-E2-gRNA2
Plasmid#131052PurposeSOX17 Knock outDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mouse Chmp2b
Plasmid#242422PurposeExpression of a Chmp2b-targeting shRNA in mouse cellsDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbmiR164e/h
Plasmid#231157PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbmiR164e/hDepositorInsertmobile gRNA targeting NbmiR164e/h
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only