We narrowed to 51,041 results for: des.1
-
Plasmid#210428PurposeBacterial expression of MBP-PB1(1-122) with TEV cleavage siteDepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pCxcl1-Firefly-1-Tbx5-site
Plasmid#177832PurposeLuciferase reporter for mouse Cxcl1 with one Tbx5 consensus binding siteDepositorInsertLuciferase
UseLuciferasePromoterCxcl1Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 Hs 1-12 3xFLAG
Plasmid#111965PurposeHuman HEATs 1-12 have been inserted into Hsh155 3xFLAG.DepositorInsertHsh155 Hs 1-12 3x FLAG
Tags3xFLAGExpressionBacterial and YeastMutationHuman HEATs 1-12 insertedAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 Hs 1-5 3xFLAG
Plasmid#111963PurposeHuman HEATs 1-5 have been inserted into Hsh155 3xFLAG.DepositorInsertHsh155 Hs 1-5 3x FLAG
Tags3xFLAGExpressionBacterial and YeastMutationHuman HEATs 1-5 insertedAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 dATG1 (1188)
Plasmid#66918Purposebacterial expression of dATG1DepositorInsertATG1
TagsGSTExpressionBacterialPromotertacAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-p53 (Cow 1-82)
Plasmid#62062PurposeExpression of Cow p53 (residues 1-82) in e. coliDepositorInsertp53
TagsHisExpressionBacterialMutationcontains TAD residues 1-82PromoterT7Available SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28-p53 (Rabbit 1-87)
Plasmid#62058PurposeExpression of Rabbit p53 (residues 1-87) in e. coliDepositorInsertp53
TagsHisExpressionBacterialMutationcontains TAD residues 1-87PromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
LI D-E 1-10GFP
Plasmid#54452DepositorInsert16 aa GS linker + superfolder GFP 1-10 domain
UseCloning vectorAvailable SinceNov. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
3xAP1pGL3 (3xAP-1 in pGL3-basic)
Plasmid#40342DepositorInsert3xAP-1
UseLuciferaseTagsLuciferaseExpressionMammalianMutationContains three canonical AP-1 binding sites (TGAC…Available SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Puro shRNA Scramble
Plasmid#162011PurposeLentiviral negative control vector containing scramble shRNADepositorInsertscramble shRNA
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
NFAT/AP-1 3x luciferase
Plasmid#11783DepositorAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP -1
Plasmid#194321PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP +1
Plasmid#194306PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Myc-His(-)-HSulf-1
Plasmid#13003DepositorInserthuman sulfatase 1 (SULF1 Human)
ExpressionMammalianAvailable SinceOct. 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MT-hToca-1-wt
Plasmid#33030DepositorAvailable SinceNov. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Rheb1 shRNA #2
Plasmid#26626DepositorAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-human p53-(1-393)
Plasmid#24860DepositorAvailable SinceAug. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-FOXM1-shRNA-#1
Plasmid#89498PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.DepositorInsertFOXM1 (FOXM1 Human)
UseLentiviral and RNAi; Doxycycline inducibleExpressionMammalianPromoterH1/TOAvailable SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR4-GFP-C1 (w392-1)
Plasmid#17396PurposeGateway entry vector for N-term eGFP fusion, frame C1DepositorInsertGFP
UseEntry vectorExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only