We narrowed to 704 results for: des.1
-
TypeCollection...oligos 1:10 in ddH 2 O ( e.g., 1.0 μl annealed oligos + 9.0 μl ddH 2 O to yield a concentration of 1 μM)....35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10 min. Optimize PCR ...the page. CRISPR Design Design sgRNAs manually or using freely available online tools 1 . Use these tools...at the genomic recognition site. NOTE: Figure 1 describes possible deletion strategies for genes and non-coding...Use the example guides for the intended deletion of Pim1 in mouse ( Mus musculus ; Table 1 , Figure 2A )...Deletions in Mammalian Cell Lines via CRISPR/Cas9. Bauer DE, Canver MC, Orkin SH. J. Vis. Exp. (95), e52118, ...complement sequences of the Pim1 sgRNA from Table 1 are found in Table 2 . Obtain 24- or 25-mer oligos...
-
CRISPR Plasmids - Cascade-Cas3
TypeCollection...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex, comprised of a combination of Cas5...endogenous repair mechanisms. Cas3 belongs to the Class 1 family of CRISPR systems, the most abundant type found...bacteria and archaea. While abundant in nature, Class 1 systems are largely underutilized compared to their...still separate the individual Cas components. Figure 1: Overview of Cascade-Cas3 mechanism. Created with ...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Cas3 is a unique member... -
Neurodegeneration Plasmid Collection
TypeCollection...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [... pLKO.1 mTagBFP2 rat DJ-1 shRNA PARK7 U6 Parkinson's Timothy Ryan 223563 pmCherry-Synaptojanin-1-145 SYNJ1... His, V5 EF-1 alpha Parkinson's Mark Cookson 25082 pDEST51-LRRK2-R1441G LRRK2 His, V5 EF-1 alpha Parkinson's... His, V5 EF-1 alpha Parkinson's Mark Cookson 29399 pDEST51-LRRK2-I1371V LRRK2 His, V5 EF-1 alpha Parkinson's...pcDNA3-FLAG-Synaptojanin 1-145 SYNJ1 Flag CMV Parkinsonism, early-onset Pietro De Camilli 22292 pcDNA3-FLAG-Synaptojanin...-FLAG-Synaptojanin 1-170 SYNJ1 Flag CMV Parkinsonism, early-onset Pietro De Camilli 22293 pEGFPC1-FLAG-Synaptojanin... -
Immunology Research Plasmids and Resources
TypeCollection...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha... -
Penn Vector Core Partnership with Addgene
TypeCollection...Function PI AV-1-49531P 100040-AAV1 pAAV.hSyn1.Twitch2B.WPRE.SV40 Biosensor Oliver Griesbeck AV-1-50942 50942...Tobias Rose AV-1-PV2723 98929-AAV1 pAAV.hSyn.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2724 98931... Looger AV-1-PV2725 98932-AAV1 pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2816 100835... Kim AV-1-PV2817 100839-AAV1 pAAV.CAG.Flex.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2818 ... Kim AV-1-PV2819 100833-AAV1 pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2820 ... Kim AV-1-PV2821 100845-AAV1 pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2822 ...Douglas Kim AV-1-PV2823 100841-AAV1 pAAV.Syn.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2824 100843... -
Optogenetics AAV Preps
TypeCollection...Constitutive 1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell...Constitutive 1, 2, 5, 9 Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden...dependent 1, 5, 9, rg* Deisseroth 26971 pAAV-CaMKIIa-eNpHR 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 ...Constitutive 1, 5, rg* Yizhar 125713 AAV-hSyn1-SIO-eOPN3-mScarlet-WPRE Syn eOPN3 mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198511 pAAV_hSyn-DIO-PdCO-mScarlet-WPRE Syn PdCO mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198516 pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE EF1a PdCO mScarlet Cre dependent 1, 5 Yizhar... -
CRISPR Pooled gRNA Libraries
TypeCollection...aeruginosa PA14 234855 (Set 1) 1000000254 Inhibition P. aeruginosa X. Liu NA 1 5,981 (Set 1) 5,971 (Set 2) CHyMErA... Human Doench 3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313...Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut - Version 3 90294 (1 plasmid...Library 182133 Knockout Human Mali 3rd 1 74 Perturb-seq Guide Barcodes (GBC) 85968 Barcode Human Weissman ...Libraries 153101-153106 Knockout Yeast Borodina N/A 1 Varies Bovine CRISPR Knockout Libraries 213927, 213928...pgRNAs 1,718 Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and...Root 3rd 4 76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...phosphosite library as GST-fusion peptides (“Mode #1” expression). The Mode #1 phosphosite library (Pooled ...References & Protocols Additional Resources Figure 1: SepRS adds a phosphoserine to tRNA^Sep with anticodon...standards for quantitative assessments. The Mode #1 phosphosite library can be generated with either phosphoserine...phosphorylation-dependent protein-protein interactions Figure 2: Mode #1 and Mode #2 phosphosite library configuration for ...Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also be synthesized using ...iSPI_pSer_Subpool#2 Pooled Library 188526 iSPI_pSer_Subpool#1 Plasmid 112031 pNAS1b split mCherry 14-3-3β ctrl Plasmid... #2 Library (14-3-3β) Pooled Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid... -
Fluorescent Protein Guide: Biosensors
TypeCollection...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...chloroplasts to nuclei provides a high-light signalling mechanism. Nat Commun. 2017 Jun 29;8(1):49. Philip Mullineaux...of cellular physiology. Nat Commun. 2020 Aug 4;11(1):3881. Adam Cohen Calcium GCaMP6f expression in forebrain...Dynamics in High-Ca Organelles. Cell Chem Biol. 2016 Jun 1. pii: S2451-9456(16)30163-5. Teresa Alonso , Javier... intracellular calcium. Nat Commun. 2021 Dec 9;12(1):7159. Dorus Gadella Calcium Teal genetically encoded...Neurophotonics. 2024 Apr;11(2):024207. doi: 10.1117/1.NPh.11.2.024207. Robert Campbell Calcium Ratiometric...orange-emitting fluorescent proteins. Nat Commun. 2017 Sep 5;8(1):431. Wolf Frommer Calcium Red-, yellow-, or cyan-... -
AAV Molecular Tools
TypeCollection...bicistronic expression of designer pro-taCasp3 and TEVp for studying cell ablation. 1, 5 Shah , Wells Genome...positive feedback loop for amplified tTA expression. 1 Gradinaru 99121 pAAV-ihSyn1-DIO-tTA Cre-dependent ...positive feedback loop for amplified tTA expression. 1 Gradinaru 117383 TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible...Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1 Gradinaru Tools for Affinity Purification These AAV...synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...synaptophysin-mRuby for labeling of axon terminals. 1 Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven...microtubule-associated protein tau with P301L mutation 1 Ikezu Don’t See What You’re Looking For? Our Packaged... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1...Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome WIPI1 EGFP Noboru...apparatus eNOS(1-33) CFP Alexandra Newton 36205 pmTurquoise2-Golgi Golgi apparatus B4GALT1(1-61) mTurquoise2... Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae...COXIV-COX8-dL5-2XG4S-mCer3 Mitochondria COX IV-derived (1-22 aa) import sequence and COX VIII signal peptide...Verkhusha 36208 pmTurquoise2-Mito Mitochondria COX8A(1-29) mTurquoise2 Dorus Gadella 26673 pEGFP-C1-Fibrillarin... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...AdEasier®-1 cells (strain) - Bacterial strain that contains AdEasy®-1 plasmid...marker pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination vector, expression, CMV/...GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP DEST - ...N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...expression under a CMV promoter pAdEasy®-1 - Recombine plasmids from the shuttle... Tet-inducible lentiviral shRNA expression pLKO.1 - TRC cloning vector - Lentiviral shRNA expression... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin... HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin...human cell lines of their choice. For a full description of how to use these plasmids, check out Plasmids... -
Adenovirus Plasmids
TypeCollection...plasmid Vogelstein 16399 AdEasier-1 BJ5183 derivative that contains AdEasy-1™ plasmid Vogelstein Adenoviral... that have inserts. ID Plasmid Type Description PI 16400 pAdEasy-1 Adenoviral For recombining shuttle ...for the AdenoBuilder genome assembly system. Block 1 with deletion in E1 and insertion of GFP expression...strains for generating adenovirus. ID Strain Description PI 16398 BJ5183 Strain for recombination between... be assembled in a one-tube reaction. ID Kit Description PI 1000000176 AdenoBuilder toolkit Plasmids contain... -
Plasmids for Stem Cell Research
TypeCollection... cell reprogramming factors and wait for cells to de-differentiate. However it may be difficult to decide... with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human...cell reprogramming. Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating...vector. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible...transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory Neurons Lentiviral...peripheral sensory neurons. Nat Neurosci. 2015 Jan;18(1):25-35. Baldwin Fibroblasts iTSCs Lentiviral Mouse... from Human ALS Patients. Cell Rep. 2016 Jan 5;14(1):115-28. Zhang Adult Dermal Fibroblasts Neurons Lentiviral... -
AAV Packaged on Request
TypeCollection...Small NEW 2 × 100 µL aliquots 0.2 mL 4 × 10 12 GC/mL* 1 × 10 13 GC/mL* Medium 10 × 100 µL aliquots 1.0 mL ...to 10 weeks. This breaks down as follows: Request 1–2 days Look for the banner on an eligible plasmid ...place your request. We will send you an email within 1-2 days with a response. Most requests will be approved... we can begin processing your order. MTA Approval 1+ business days, varies by requesting organization ...scientist through an MTA. This process typically takes 1–4 days, depending on your institution. AAV Production...all-in-one pricing for viral vector preps, which includes MTA facilitation, DNA amplification, and high-... -
CRISPR History and Development for Genome Engineering
TypeCollection...foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. 2014. Genome-Scale CRISPR-Cas9...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows... -
Validated gRNA Sequences
TypeCollection...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono pMB60 47941...Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian/Lentiviral...Zebrafish BseRI none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin...see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/...Puro Zoldos pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta...expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent promoters. sgRNAs...for the expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes... -
CRISPR Guide
TypeCollection...M. M., Semenova, E., Severinov, K., De Vos, W. M., Dame, R. T., De Vries, R., Brouns, S. J., & Van Der... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex to initiate DNA degradation. Cascade...Cascade C RISPR- as sociated c omplex for a ntiviral de fense; a complex of multiple Cas enzymes including...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...