We narrowed to 15 results for: des.1

...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD... with a specifically designed Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...

...M. M., Semenova, E., Severinov, K., De Vos, W. M., Dame, R. T., De Vries, R., Brouns, S. J., & Van Der...changing the target sequence present in the gRNA. Figure 1: Overview of the basic CRISPR mechanism. CRISPR was...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex to initiate DNA degradation. Cascade...Cascade C RISPR- as sociated c omplex for a ntiviral de fense; a complex of multiple Cas enzymes including...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...

...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...Oncolytic Referring to the destruction of cancer cells, generally by lysis. pAdEasy-1 Adenoviral backbone plasmid...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or... This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli ... viruses. The adenoviral backbone plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For...production system. Figure is based on the use of pAdEasy-1. Created with BioRender.com. AdMax™ AdMax™ is another...landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392-021-00487-6 (...

...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate TALEN and...functional genetic circuit. Level 2 vectors are often designed with flexibility to allow for additional iterations...MoClo kits in our collection. Kit name Type PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet...

...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L... Science Guides Optogenetics Guide Optogenetics Guide Jump To: ...cell membrane. Microbial opsins, such as those described below, can be targeted and expressed in specific...

...transcribed gene (Figure 1). The coding strand is the DNA strand that encodes codons and whose sequence...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...or inducible expression. Promoter Expression Description T7 Constitutive Promoter from T7 bacteriophage...different conditions. Promoter Expression Species Description Ac5 Constitutive Insect Strong promoter from ...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...primers. You can also use Addgene’s protocol to design your own primers . Still have questions about choosing... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...

...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell... Science Guides Viral Vectors AAV Vector Guide Adeno-Associated...inverted terminal repeats (ITRs). The Rep region encodes four non-structural replication proteins (Rep78...

...start designing the specific components (Cas enzyme and guide RNA) for your experiment (Figure 1). You...gRNA), the design of the gRNA sequence, and finally how to validate your genetic edit. Figure 1: Flow chart...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...used for gRNA design. Read more about how to design your gRNA . Synthesize and Clone Desired gRNAs Once ...multi-plasmid SAM system Activate Design and Clone Your gRNA Achieving your desired edit comes down to location...on proper gRNA design. While there are some cases where it makes sense to manually design a gRNA, in most...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...pairs with G. The order of nucleotides makes up the genetic code and provides the instructions to make ...thymine in RNA molecules. Every 3 nucleotides (codons) in a DNA sequence encodes for an amino acid. The genetic...double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form hydrogen ...

...Retroviral Vector Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com...PMID: 24501411 Gilroy, K. L., Terry, A., Naseer, A., De Ridder, J., Allahyar, A., Wang, W., Carpenter, E.... Science Guides Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral...been widely used in the research community for decades. Wildtype gamma-retroviruses have been engineered...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...

...also negatively affect data reproducibility. Figure 1: Simplified flow chart for amplifying and using a ... Science Guides Guide to Plasmid Pooled Libraries Plasmid Pooled...effects of expressing multiple genes at once. A well-designed screen can help you begin to understand what genes...important to a certain phenotype, and allow you to design additional hypothesis-directed experiments. As ...tube. Pooled libraries can be small, if they are designed to cover only a subset of genes, or very large...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for... is described in more detail in the Multiplex Assays section below. The following table describes the ... Science Guides Antibody Guide Antibody Guide View Addgene's Antibody...of B cells isolated from animals immunized as described above are used to create hybridomas, which produce...each antibody has two binding sites. Isotype Description Configuration and Valency Subclasses IgA Prevalent... used to quantify relative amounts of protein. Includes: Western blot ELISA Capture - used to isolate ...

...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest...for it to then be digested and ligated into your desired plasmid. It is important to note that restriction...enzymes that cut your insert or backbone at only the desired location for your cloning project. Restriction ...rapidly shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase...bacterial recombination to easily move it into any destination plasmid that fits your experimental goal. Although... Gateway donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection...Any dsDNA fragments can be used, so if properly designed, any insert fragment (PCR product or synthesized...