We narrowed to 9,076 results for: sgRNA
-
Plasmid#158989PurposeVector F encodes pAAV-pMecp2-dSaCas9-SID4X-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-SID4X
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL6 sgRNA(MS2)-MS2-hA3a D131E
Plasmid#112132Purposeempty sgRNA cloning vector with MS2-humanA3a D131EDepositorInserthuman Apobec3a D131E mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationD131E mutant in hA3aPromoterhU6,CBhAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK-puromycin-AflII
Plasmid#106404PurposeEmpty guide RNA cloning vector with an AflII site added from Addgene 41824DepositorTypeEmpty backboneExpressionMammalianPromoterU6Available sinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV hU6-Non-target sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196989PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with non-target sgRNADepositorInsertNon-Target
UseCRISPR and LentiviralAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-PGK-hCD2
Plasmid#224294PurposeExpresses sgRNA from U6 promoter and human CD2 under PGKDepositorInsertU6 sgRNA cassette with CD2 under PGK promoter (CD2 Human)
UseCRISPR and RetroviralExpressionMammalianPromoterU6/PGKAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-Puro (pRW1441)
Plasmid#216217PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi construct with Puromycin resistanceDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-GFP-TRIM28
Plasmid#185010PurposeEncodes gRNA for mouse TRIM28 along with Cas9 with 2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTRIM28 sgRNA (Trim28 Mouse)
UseCRISPRAvailable sinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 1
Plasmid#131345PurposegRNA targeting mouse TRAF6DepositorAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459_MCM2_sgRNA
Plasmid#232730PurposeGenerates MCM2 dTAG C ternimal knock-in cell linesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMCM2 (MCM2 Human)
ExpressionBacterial and MammalianMutationNOAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_CDC45_sgRNA
Plasmid#232732PurposeGenerates CDC45 dTAG C ternimal knock-in cell linesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCDC45 (CDC45 Human)
ExpressionBacterial and MammalianMutationNOAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGC_RT_Sa_sgRNA
Plasmid#136968PurposeGoldengate/Greengate module for genome editing, using the Sa guideRNA.DepositorInsertSa guide RNA
UseCRISPRAvailable sinceJan. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA RNF138 (RNF138 Human)
UseCRISPRAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF123
Plasmid#127122DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA RNF123 (RNF123 Human)
UseCRISPRAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_mouseH3.1
Plasmid#244241PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.DepositorAvailable sinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAWPSG-Po-nCas9-BE- Ptac-sgRNA(mmoX_1)
Plasmid#195741PurposeBase editing for making a pre-stop codon in mmoX using phenol inducible systemDepositorPublicationInsertDi-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI / Ptac-RiboJ-sgRNA(mmoX_1)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPo (phoenol-inducible promoter)Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only