We narrowed to 9,048 results for: sgRNA
-
Plasmid#232732PurposeGenerates CDC45 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pGGC_RT_Sa_sgRNA
Plasmid#136968PurposeGoldengate/Greengate module for genome editing, using the Sa guideRNA.DepositorInsertSa guide RNA
UseCRISPRAvailable SinceJan. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorInsertgRNA RNF138 (RNF138 Human)
UseCRISPRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF123
Plasmid#127122DepositorInsertgRNA RNF123 (RNF123 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_mouseH3.1
Plasmid#244241PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Po-nCas9-BE- Ptac-sgRNA(mmoX_1)
Plasmid#195741PurposeBase editing for making a pre-stop codon in mmoX using phenol inducible systemDepositorArticleInsertDi-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI / Ptac-RiboJ-sgRNA(mmoX_1)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPo (phoenol-inducible promoter)Available SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK-puromycin-AflII
Plasmid#106404PurposeEmpty guide RNA cloning vector with an AflII site added from Addgene 41824DepositorTypeEmpty backboneExpressionMammalianPromoterU6Available SinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-SpCas9-sgRNA
Plasmid#179582PurposeExpresses spCas9 and gRNA that targets ColE1 plasmids for curingDepositorInsertCas9
ExpressionBacterialAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pyEvolvR (enCas9-PolI5M)
Plasmid#158073PurposeExpresses enCas9 fused to PolI5M in S. cerevisiae; contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
ExpressionBacterial and YeastAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO2
Plasmid#217448PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO1
Plasmid#217447PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJW1884
Plasmid#154332PurposesgRNA Target Vector for CRISPRDepositorInsertcxTi10882 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only