We narrowed to 4,490 results for: Gca
-
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX3X-ts2
Plasmid#174236PurposeDDX3X knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 CLCN3 g1
Plasmid#170828PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW319-lenti-sg3-mmItga9-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189949PurposeLentiviral vector to co-express a mouse Itga9 spsgRNA (sg3-Itga9) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itga9 spsgRNA #3
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern/EGFP
Plasmid#188482PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCK2 gRNA (BRDN0001487084)
Plasmid#78082Purpose3rd generation lentiviral gRNA plasmid targeting human PCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK18 gRNA (BRDN0001144740)
Plasmid#77880Purpose3rd generation lentiviral gRNA plasmid targeting human CDK18DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IP6K3 gRNA (BRDN0001147058)
Plasmid#77654Purpose3rd generation lentiviral gRNA plasmid targeting human IP6K3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K9 gRNA (BRDN0001145934)
Plasmid#77310Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK3 gRNA (BRDN0001147290)
Plasmid#77313Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DGKD gRNA (BRDN0001148084)
Plasmid#77259Purpose3rd generation lentiviral gRNA plasmid targeting human DGKDDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK4 gRNA (BRDN0001146440)
Plasmid#77224Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLAU gRNA (BRDN0001162395)
Plasmid#77103Purpose3rd generation lentiviral gRNA plasmid targeting human PLAUDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HIPK3 gRNA (BRDN0001146408)
Plasmid#77032Purpose3rd generation lentiviral gRNA plasmid targeting human HIPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32C gRNA (BRDN0001149411)
Plasmid#76933Purpose3rd generation lentiviral gRNA plasmid targeting human STK32CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DGKB gRNA (BRDN0001146143)
Plasmid#76918Purpose3rd generation lentiviral gRNA plasmid targeting human DGKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKG2 gRNA (BRDN0001145745)
Plasmid#76920Purpose3rd generation lentiviral gRNA plasmid targeting human PRKG2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only