We narrowed to 17,696 results for: jun
-
Plasmid#221574PurposePlasmid containing the Insert 2 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1428
Plasmid#221575PurposePlasmid containing the Insert 3 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1429
Plasmid#221576PurposePlasmid containing the Insert 4 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB027
Plasmid#234636PurposepET-28a(+) based plasmid for expression of H16_B1102 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB028
Plasmid#234637PurposepET-28a(+) based plasmid for expression of H16_B1148 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB029
Plasmid#234638PurposepET-28a(+) based plasmid for expression of H16_B1264 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB030
Plasmid#234639PurposepET-28a(+) based plasmid for expression of H16_B1335 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB026
Plasmid#234635PurposepET-28a(+) based plasmid for expression of H16_A3514 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH643
Plasmid#230834Purposehu6-BsmBI-MS2_sgRNA-Ef1a-puroR-T2A-mCherry-wPREDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH394
Plasmid#230851PurposeEf1a-rAPOBEC1-dCas9-T2A-BlastR-wPREDepositorInsertrAPOBEC1-dCas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH398
Plasmid#230854PurposeEf1a-rAPOBEC1-n'Cas9-T2A-BlastR-wPREDepositorInsertrAPOBEC1-n'Cas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH401
Plasmid#230852PurposeEf1a-rAPOBEC1-nCas9-T2A-BlastR-wPREDepositorInsertrAPOBEC1-nCas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATM HRD
Plasmid#207085PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous ATM locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD3 HRD
Plasmid#207077PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD3 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD1 HRD
Plasmid#207076PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD1 locus.DepositorInsertHaloTag flanked by human SHLD1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T_CAG_SpCas9PE2_5plinker_BlastR
Plasmid#173066PurposeExpresses PE2DepositorInsert5plinker
ExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only