We narrowed to 6,915 results for: tac
-
Plasmid#191072Purposedop-3 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pEY81
Plasmid#191076Purposeflp-32 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY75
Plasmid#191071Purposecng-3 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY67
Plasmid#191064Purposeceh-1 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY69
Plasmid#191066Purposeceh-24 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern332
Plasmid#188483PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTagsPB_rtTA_BsmBIExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-β-actin3'UTR2
Plasmid#183717PurposetdTomato with fragment nucleotides 441-676 of beta-actin 3'UTR inserted in 3'UTRDepositorInserttdTomato with fragment (nucleotides 441-676) of mouse Actb 3'UTR
UseLentiviralPromoterUbiCAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
tdTomato--β-actin CDS2
Plasmid#183714PurposetdTomato with fragment nucleotides 398-818 of beta-actin coding sequence inserted in 3'UTRDepositorInserttdTomato with fragment (nucleotides 398-818) of mouse Actb coding dsequence
UseLentiviralPromoterUbiCAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-β-actin3'UTR1
Plasmid#183716PurposetdTomato with fragment nucleotides 1-440 of beta-actin 3'UTR inserted in 3'UTRDepositorInserttdTomato with fragment (nucleotides 1-440) of mouse Actb 3'UTR
UseLentiviralPromoterUbiCAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLBM0040
Plasmid#172819PurposeLevel 2 module containing HSP21-nYFP deltaPTAC5-cYFPDepositorInsert[35S-P19][35S-CTPSSU-mHSP21-3XFLAGnYFP][35S-CTPSSU-deltamPTAC5-cYFPX3HA][35S-SP_SV40-CFP]
UseSynthetic BiologyAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLBM0030
Plasmid#172818PurposeLevel 2 module containing HSP21-nYFP PTAC5-cYFPDepositorInsert[35S-P19][35S-CTPSSU-mHSP21-3XFLAGnYFP][35S-CTPSSU-mPTAC5-cYFPX3HA][35S-SP_SV40-CFP]
UseSynthetic BiologyAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern332
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
tcTRP24sub8
Plasmid#175796Purposede novo thick circular tandem repeat protein trimer formed from 8-repeat monomersDepositorInserttcTRP24sub8
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
tcTRP24sub8_SS
Plasmid#175798Purposede novo thick circular tandem repeat protein trimer formed from 8-repeat monomers containing disulfide 'staples'DepositorInserttcTRP24sub8_SS
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
tcTRP24sub8_SH2sub6
Plasmid#175799Purposede novo thick circular tandem repeat protein trimer formed from 8-repeat monomers containing 2 copies of human Nck2 SH2DepositorInserttcTRP24sub8_SH2sub6
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
tcTRP9sub3
Plasmid#175794Purposede novo thick circular tandem repeat protein trimer formed from 3-repeat monomersDepositorInserttcTRP9sub3
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
tcTRP24sub6
Plasmid#175795Purposede novo thick circular tandem repeat protein tetramer formed from 6-repeat monomersDepositorInserttcTRP24sub6
Tags6xHisExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only