-
Plasmid#163102PurposeExpression of mCherry_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmCherry_H-NSdbd
UseTagsExpressionBacterialMutationPromoteraraBAD promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-V1251R_R
Plasmid#147376PurposeMammalian Expression of HsNot1iso1-V1251RDepositorInsertHsNot1iso1-V1251R (CNOT1 Human)
UseTagsExpressionMammalianMutationA deletion of 5 AA 822-827 SKMKPS-> T and one …PromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
KQ403: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-LSD1
Plasmid#121831PurposepMAGIC R4-R3 entry plasmid, contains 2x NLSx-dCas9(3.7) fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot7-D40AE42A_L
Plasmid#146890PurposeMammalian Expression of HsNot7-D40AE42A. Please note that this plasmid does not contain the T7 promoter.DepositorInsertHsNot7-D40AE42A (CNOT7 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot8-D40AE42A_AH
Plasmid#148902PurposeMammalian Expression of HsNot8-D40AE42ADepositorInsertHsNot8-D40AE42A (CNOT8 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE4495
Plasmid#80338Purposemammalian expression MbCpf1 nuclease and Mb crRNADepositorInsertsMb crRNA
MbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMV and human U6Available sinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6MBW6
Plasmid#103102PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6MBW6(Cas9 coding gene from Staphylococcus lugdunensis M23590)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
KZ801: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121814PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE4560
Plasmid#107526PurposeExpresses As crRNA and mCherry in mammalian cells.DepositorInsertsAs crRNA
mCherry
UseTagsExpressionMammalianMutationPromoterCBh and human U6Available sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
KO101: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-Dnmt3a3L
Plasmid#121833PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R49A)
Plasmid#112726PurposeArg49 of TBP6.7 and other TBPs is the only arginine that was lab-evolved from wild-type U1A to play a significant role in TAR RNA recognition. Mutation results in ~230-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R49A)
UseTags6His-TEVExpressionBacterialMutationR49APromoterT7Available sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4999
Plasmid#107555PurposeExpresses human codon optimized inactive FnCpf1(dead1) in mammalian cells.DepositorInserthFnCpf1(dead1)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationD917APromoterCMVAvailable sinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-G2ZYP2
Plasmid#103110PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG2ZYP2(Cas9 coding gene from Ralstonia syzygii R24)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only