We narrowed to 4,490 results for: GCA
-
Plasmid#90553Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1DepositorInsertBUB1 (Guide Designation A6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
DSN1 C12.1 gRNA
Plasmid#90657Purpose3rd generation lentiviral gRNA plasmid targeting human DSN1DepositorInsertDSN1 (Guide Designation C12.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F1)-GFP
Plasmid#91883PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LMTK2 gRNA (BRDN0001148094)
Plasmid#76175Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK1 gRNA (BRDN0001148112)
Plasmid#75965Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDG459-HNRNPD-KO
Plasmid#233287PurposeHNRNPD KnockoutDepositorAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_2b)-PGKpuro2ABFP-W
Plasmid#208421PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE2 mutant
Plasmid#133309PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 2DepositorInserteIF3B promoter MBE2 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationgccacatgcacc changed to gcAaAaAAcaccPromotereIF3BAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA[bTub+DsxF].1046A
Plasmid#112694Purposeexpress two gRNA targeting bTub & DsxF under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[DsxF] (dsx Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001149003)
Plasmid#77404Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK1 gRNA (BRDN0001145897)
Plasmid#76807Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PDLIM1_5-1)-PGKpuroBFP-W
Plasmid#211978PurposeExpress gRNA against PDLIM1 with puro and BFPDepositorInsertsgRNA targeting PDLIM1 (PDLIM1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Bilbo -eCMV-CjSpD8A-3XFLAG-SV40 NLS-ITR2
Plasmid#210749PurposeCoding for CjSp D8A alongside Bilbo sgRNA targeting CAG repeatsDepositorInsertsCjSp D8A Cas9
Bilbo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD8A, N-terminal Cj Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 2- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210738PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 2DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 4- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210740PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 4DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs58692659-guide2
Plasmid#125453PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs58692659 (ZFAND3 GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only