We narrowed to 8,607 results for: PAN
-
Plasmid#122604PurposeBE PACE selection, express gIII, luxAB and degron-GTCCA guide RNADepositorInsertgIII, luxAB, guide RNA
UseSynthetic BiologyAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNZ18-CAH
Plasmid#203159PurposeReplicates in E. coli, S. cerevisiae, and A. laidlawiiDepositorInsertYeast centromere, autonomously replicating sequence, histidine auxotrophic marker
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAL1
Plasmid#197285PurposeShuttle plasmid that replicates in E. coli, S. cerevisiae, and A. laidlawii. Contains the OriC from A. laidlawii 8195DepositorInsertOrigin of replication of A. laidlawii 8195: whole dnaA gene, plus upstream and downstream intergenic regions
UseSynthetic Biology; Bacterial and yeast cloningAvailable SinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-RLuc
Plasmid#188312PurposeExpression of Renilla luciferase via a T7 promoter in TXTLDepositorInsertRenilla luciferase
UseLuciferase and Synthetic BiologyTags8x His-tagExpressionBacterialPromoterT7MaxAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ-mgU2-47
Plasmid#127585PurposeExpresses mgU2-47 scaRNA from a mU6 promoterDepositorInsertmgU2-47 scaRNA
ExpressionMammalianPromotermodified U6Available SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRCA360 - pBA904 Puro-T2A-GFP
Plasmid#238164PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseLentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAUC40
Plasmid#71298PurposeSuicide Vector, Gateway attR-Chloramphenicol resistance cassette cloned in pKNG101DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEC2861 (pSpy1C-PgyrA_ffluc)
Plasmid#218511Purposereplicative E. coli-S. pyogenes shuttle plasmid, constitutive expression of firefly luciferase reporterDepositorInsertffluc
UseLuciferaseMutationdeletion of Plac_mrfp cassettePromoterPgyrAAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Thy1.1 DEST
Plasmid#17442PurposeDestination vector derived from MSCV-IRES-Thy1.1. Please note that this plasmid contains attB1 and attB2 sites for use in a BP reactionDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRCA422 - pHR-UCOE-SFFV-VPH-dcas9-p2a-mCherry
Plasmid#238165PurposeExpress VPH-dCas9-P2A-mCherry in mammalian cells. LentiviralDepositorInsertVPH-dCas9-P2A-mCherry
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
Myosin-IIA-GFP
Plasmid#38297DepositorAvailable SinceNov. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCKmatBC
Plasmid#138587PurposematBC cassette from R. trifolii controlled by a Plac promoter; pSC101 ori, catDepositorInsertbicistronic cassette containing a malonate transporter (matC) and a malonyl-CoA synthetase (matB)
UseSynthetic BiologyExpressionBacterialMutationmatB contains native GUG start codonPromoterPlac promoterAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT525
Plasmid#131392PurposeL1RP retrotransposition reporterDepositorInsertL1RP GFP-AI
ExpressionMammalianAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgControl
Plasmid#230080PurposeCrispr knock out controlDepositorInsertnon-specific sequence control
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBES1-LacOx50-mCh-bla
Plasmid#210260PurposeIntegrates 50xLacO repeats and an mCherry gene upstream of the BES1 promoter with a hygromycin drug selection marker downstream of the promoter.DepositorInserts50xLacO repeats derived from: PMID: 12864855.
mCherry
Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only