We narrowed to 435 results for: hepatitis
-
Plasmid#206959PurposeThe ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the NheI/NotI sites of the pET21b(+), the bacterial expression vector.DepositorInsertHNF4a (Hepatocyte Nuclear Factor alpha4 Variant 2) (HNF4A Human)
ExpressionBacterialPromoterT7Available SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2 HRS-RFP
Plasmid#29685DepositorInserthepatocyte growth factor-regulated tyrosine kinase substrate (HGS Human)
TagsRFPExpressionMammalianAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pCI-Neo-p53mut
Plasmid#99239PurposeMutant p53 encoded by AS-30D rat hepatoma cell lineDepositorInsertp53 (Tp53 Rat)
ExpressionMammalianMutationSilent mutations in translated protein at Gly (10…PromoterCMV immediate/early enhancer/promoterAvailable SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0; cmlc2:EGFP
Plasmid#230075PurposePartial ablation using NTR2 and subsequent lineage tracing of regenerating hepatocytes in zebrafish.DepositorInsertlox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0
UseCre/Lox; Zebrafish expressionPromoterfabp10aAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-HKIImut
Plasmid#99240PurposeType II Hexokinase expressed in AS-30D rat hepatoma cell lineDepositorInsertHexokinase II (Hk2 Rat)
ExpressionMammalianMutationFour silent mutations; P (115)L, A (192) V, F (78…PromoterCMV I.E.Available SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA
Plasmid#183776PurposeAAV genome with a CAG driven Cre recombinase with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertCre
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWAP-HGF
Plasmid#83503PurposeGeneration of transgenic mice overexpressing the HGF under the control of the WAP gene promoterDepositorInsertHGF (Hgf Mouse)
UseMouse TargetingMutationalso contains beta-globin sequences from pUC198Promotermouse WAP (whey acidic protein)Available SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ucp1-Cre-miR122
Plasmid#228408PurposeExpression of Cre recombinase from a rat Ucp1 enhancer-promoter. Contains miR122 target sequences that suppress expression in hepatocytes.DepositorInsertscre recombinase with SV40 NLS
Cre recombinase with SV40 NLS
UseAAVPromoterrat Ucp1 enhancer-promoterAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist-CMV-HDGFL2_WT_TwinstrepTEV_6xHis
Plasmid#232343PurposeExpresses wild-type human HDGFL2 protein with an N-terminal twinstrep tag + TEV protease site and C-terminal His-tagDepositorInsertHDGF like 2 (HDGFL2 Human)
TagsGGGS linker, 6xHis and Twin-strep, TEV protease s…ExpressionMammalianAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKE4-I-SceI-fabp10a:Xpt-β-cat, cryaa:Venus
Plasmid#105127PurposeUsed along with I-SceI enzyme to generate transgenic zebrafish expressing hepatocyte-specific Xenopus activated beta-catenin and lens-specific Venus fluorescent proteinDepositorInsertsUseZebrafish transgenesisPromotercryaa (crystallin) and fabp10aAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTwist-CMV-HDGFL2_Cryptic_TwinstrepTEV_6xHis
Plasmid#232344PurposeExpresses human HDGFL2 protein with TDP-43 regulated cryptic exon, along with an N-terminal twinstrep tag + TEV protease site and C-terminal His-tagDepositorInsertHDGF Like 2 (HDGFL2 Human)
TagsGGGS linker, 6xHis and Twin-strep, TEV protease s…ExpressionMammalianMutationTDP-43 regulated cryptic exonAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MET
Plasmid#23889DepositorInsertMET (MET Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only