We narrowed to 4,547 results for: BRE
-
Plasmid#213169PurposeVector with sgGFP used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgGFP
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgAAVS1_145
Plasmid#213170PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-mProser1-FLAG-IRES-Blast
Plasmid#226173PurposeExpresses full length mouse PROSER1 with 2X C-terminal FLAG tagsDepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_YtoW
Plasmid#224253PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_YtoWDepositorInserthnRNPA1_YtoW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationY52W, Y59W, Y75W, Y81W, Y110W, Y120W, Y129WPromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1_oROS-HT_LF(C199S)
Plasmid#216412PurposeExpresses the loss-of-function mutation C199S of the genetically encoded, chemigenetic hydrogen peroxide sensor oROS-HT in mamalian cells.DepositorInsertoROS-HT_LF(C199S)
ExpressionMammalianPromoterCMVAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 Ta-sro1 WWE-PARP
Plasmid#192548PurposepENTR plasmid Triticum aestivum sro1, amino acids 1-434, cultivar SR3, no stop codonDepositorInsertSIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
UseGateway CloningAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPINF Ta-sro1 PARP
Plasmid#192549PurposeE. coli expression vector for Triticum aestivum sro1 PARP domain (amino acids 246-434)DepositorInsertSIMILAR TO RCD ONE 1 (SRO1) PARP domain, cultivar Shanrong No. 3 (SR3)
TagsHis6, 3C protease cleavage siteExpressionBacterial, Insect, and Mamm…PromoterT7 promoterAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph18_eGFP_CCR5TC
Plasmid#187443PurposeEncodes a specific PSD-95 binder (Xph18) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph18
UseAAVTagseGFPExpressionMammalianPromoterSynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph15_eGFP_CCR5TC
Plasmid#187442PurposeEncodes a specific PSD-95 binder (Xph15) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph15
UseAAVTagseGFPExpressionMammalianPromoterSynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Dcst1-3xHA
Plasmid#183540PurposeExpress Dcst1-3xHA under the mouse Clgn promoter.DepositorAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Dcst2-3xHA
Plasmid#183541PurposeExpress Dcst2-3xHA under the mouse Clgn promoter.DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmAGO2-RC_B
Plasmid#145981PurposeInsect Expression of DmAGO2-RCDepositorInsertDmAGO2-RC (AGO2 Fly)
ExpressionInsectMutationA deletion of AA 51-56 and an insertion of 23 AA …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c022
Plasmid#175490PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be biotinylated.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c028
Plasmid#175470PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains H288A point mutation that reduces binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c021
Plasmid#175468PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R point mutation that reduces binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c001
Plasmid#175466PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Used for crystallography (PDB:6TXQ).DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(WT)-mouse-full-length-CHMP3-HA
Plasmid#154175Purposeexpresses mouse CHMP3 in mammalian cellsDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only