We narrowed to 1,691 results for: CAG promoter
-
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAH750
Plasmid#91212Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters, structurally optimized gRNA scaffolds)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-mfn2 guide
Plasmid#121993PurposeAn entry vector with U6a and U6c promoter driving mfn2 guide RNAs expressionDepositorInsertmfn2 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC39
Plasmid#104813PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101180 (Cop-like). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr2g101180
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCas9-10xSunTag(22aa)
Plasmid#215745PurposeExpresses dCas9 with 10 GCN4 epitopes separated by 22 amino acid linkersDepositorInsertdCas9-10xSunTag
ExpressionMammalianPromoterchicken beta-actin promoterAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-PDS3_IMS
Plasmid#112875Purposebinary vector for IMS (Induced Mis-Splicing) of PDS3 in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting PDS3
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti.hUbC.H2B-CeruleanFP-2A-Dendra2FP.W
Plasmid#126522PurposeLentivector that expresses H2B-Cerulean and Dendra2 fluorescent proteins from an internal hUbC promoter.DepositorInsertH2B-CeruleanFP-2A-Dendra2FP
UseLentiviralPromoterhUbCAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Tra].1046D
Plasmid#112693Purposeexpress two gRNA targeting bTub & Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only