We narrowed to 165,637 results for: Gene
-
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1TCbt
Plasmid#44514DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-1.03kb-EGFP
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hSncg-EGFP
Plasmid#153198PurposeHuman gamma-synuclein (hSncg) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
SL537
Plasmid#49945PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL536
Plasmid#49942PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL534
Plasmid#49940PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
SL535
Plasmid#49941PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL539
Plasmid#49948PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJL358
Plasmid#243712PurposeA piggyBac vector containing the COX7A2 coding sequence (CDS) flanked by the 5' UTR of the COX7A2 gene and 3' UTR of the ACTB geneDepositorInsert5' UTR and CDS of COX7A2, followed by the 3' UTR of the ACTB gene (COX7A2 Human)
ExpressionMammalianPromoterendogenous promoterAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP979
Plasmid#239901PurposeCaMV 35S-SynPro-14 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-14::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP955
Plasmid#239877PurposeTCTP-SynPro-08 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-08::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only