We narrowed to 16,430 results for: grn
-
Plasmid#172829PurposeMammalian expression of a sgRNA targeting the intron 1 position 5 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i3 sgRNA / hSpCas9
Plasmid#172827PurposeMammalian expression of a sgRNA targeting the intron 1 position 3 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i2 sgRNA / hSpCas9
Plasmid#172826PurposeMammalian expression of a sgRNA targeting the intron 1 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA3
Plasmid#136458PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA5
Plasmid#136460PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0217_Cq-U6-2b_2xBbsI-gRNA
Plasmid#169339PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0217_Cq-U6-2b_2xBbsI-gRNA
UseCRISPRExpressionInsectPromoterCPIJ039728Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PGC1a1 sgRNA
Plasmid#165425PurposeExpression of gRNA against human PGC-1a variant 1DepositorInsertgRNA against PGC-1a variant 1 (PPARGC1A Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330 WAPL gRNA
Plasmid#165595PurposeInsertion of WAPL degromDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330 BRM gRNA
Plasmid#165586PurposeInsertion of BRM degronDepositorAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-ttn.1_C3
Plasmid#140866PurposesgRNA synthesis vector for ttn.1_C3 (zebrafish titin .1).DepositorInsertzebrafish ttn.1_C3 sgRNA for in vitro transcription (ttn.1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_FANCF-mcherry
Plasmid#159786PurposeS. pyogenes sgRNA collocated with pegRNA targeting human FANCF geneDepositorInsertspacer of sgRNA targeting FANCF gene (FANCF Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Myosin7B-sgRNA
Plasmid#154861PurposeLentiviral expression of Cas9 and sgRNA targeting Myosin7BDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 S3070F
Plasmid#139325PurposePlasmid expressing a sgRNA to introduce BRCA2 S3070F using base editingDepositorInsertsgRNA to insert BRCA2 S3070F using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 S1363L
Plasmid#139329PurposePlasmid expressing a sgRNA to introduce BRCA1 S1363L using base editingDepositorInsertsgRNA to insert BRCA1 S1363L using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E1754K
Plasmid#139330PurposePlasmid expressing a sgRNA to introduce BRCA1 E1754K using base editingDepositorInsertsgRNA to insert BRCA1 E1754K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA FANCD2 Q223Stop
Plasmid#139332PurposePlasmid expressing a sgRNA to introduce FANCD2 Q223Stop using base editingDepositorInsertsgRNA to insert FANCD2 Q223Stop using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2896C
Plasmid#139511PurposePlasmid expressing a sgRNA to introduce BRCA2 R2896C using base editingDepositorInsertsgRNA to insert BRCA2 E2896C using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LMX1B-gRNA-C-del
Plasmid#131516PurposegRNA to delete a nucleation site near Lmx1b. Use with LMX1B-gRNA-N-delDepositorInsertLMX1B-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only