We narrowed to 171,035 results for: Gene
-
Plasmid#128703PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcE-avrE1
ExpressionBacterialMutationThree synonymous mutations Ala 362 (GCT-GCC), Ala…Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterEF1a and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins2
Plasmid#195039PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
natMX6-ins5
Plasmid#195042PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSyn1-EGFP
Plasmid#153187PurposeMouse synapsin-1 (mSyn1) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSHUT4-eYFP
Plasmid#133094PurposeAgrobacterium T-DNA overexpression cassette comprising constitutive TEF-1alpha fused to reporter eYFP. Integrates near beta-tubulin gene in F. solani genome. Replace eYFP w/ XhoI BamHIDepositorInsertenhanced yellow flourescent protein
UseFungal expressionPromoterTEF-1αAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB137 - pL2_pSB90_pNOS::rLUC-I::tNOS_tOCS::fLUC-I::pSTR1
Plasmid#123194Purposebinary plant vector for transient dual luciferase (rLUC & fLUC with introns) expressionDepositorInsertpNOS::rLUC-I::tNOS tOCS::fLUC-I::pSTR1
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRP1MX6-ins4
Plasmid#195041PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertTRP1
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dMFot
Plasmid#44558DepositorInsertsPTETREG promoter
rtetR-M2::FFF
UseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D…PromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTN6kwh
Plasmid#44724DepositorInsertspCMV-D2i promoter
htetR::NLS
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins6
Plasmid#195043PurposepFA6a derived selection cassette 5' flanked with tDEG1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
his3MX6-ins3
Plasmid#195040PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertHis5+
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLD-CAG-DYSF-CFL
Plasmid#131457PurposeEncodes Dysferlin protein (Therapeutic gene) along with Follistatin protein to cure LGMD2B along with luciferase enzyme for in vivo live imagingDepositorExpressionBacterial and MammalianMutationR15C (in DYSF) and Q2579H (in CFL)Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only