We narrowed to 11,549 results for: 158

#215833

Template for in vitro transcription of CBE6a (with SpCas9)

David Liu

Zhang et al Nat Commun. 2024 Feb 24;15(1):1697. doi:

March 8, 2024

Academic Institutions and Nonprofits only

#102320

expression of r-luciferase

Rudolf Jaenisch

Kanarek et al Nature. 2018 Jul 11. pii: 10.1038/s41586

July 13, 2018

Academic Institutions and Nonprofits only

#124650

Soma-localized C1V1(t/t) for dense expression in excitatory neurons

Christopher Harvey

Chettih et al Nature. 2019 Mar 6. pii: 10.1038/s41586-

April 16, 2019

Academic Institutions and Nonprofits only

#200167

Expresses HA-tagged human NLGN1

Paul Blainey

Le et al Cell Rep. 2025 Jun 24;44(7):115889. doi:

July 2, 2025

Academic Institutions and Nonprofits only

#215836

Template for in vitro transcription of CBE6d (with SpCas9)

David Liu

Zhang et al Nat Commun. 2024 Feb 24;15(1):1697. doi:

March 8, 2024

Academic Institutions and Nonprofits only

#117158

Target site ATAAGGAAGCACTCGATGTCG

Jeremy Luban

McCauley et al Nat Commun. 2018 Dec 13;9(1):5305. doi:

March 14, 2019

Academic Institutions and Nonprofits only

#183158

Bimolecular fluorescence complementation (BiFC) vector for transient expression of C-truncated Venus in plants. Unique nucleotide sequences Uc and Ud for cloning at C terminus of Vc.

Yao-Guang Liu, Qinlong Zhu

Han et al Plant Biotechnol J. 2022 Feb 18. doi: 10

April 26, 2022

Academic Institutions and Nonprofits only

#102335

Human R-Ras2 with FLAG tag for mammalian expression

Hening Lin

Zhang et al Elife. 2017 Apr 13;6. pii: e25158. doi:

July 10, 2018

Academic Institutions and Nonprofits only

#36158

David Stephens

Hughes et al J Cell Sci. 2010 Dec 1;123(Pt 23):4032-8

July 27, 2015

Academic Institutions and Nonprofits only

#215831

Express CBE6c (with eNme2-C variant) in mammalian cells

David Liu

Zhang et al Nat Commun. 2024 Feb 24;15(1):1697. doi:

March 8, 2024

Academic Institutions and Nonprofits only