We narrowed to 7,801 results for: aav
-
Plasmid#214601PurposeAiE2586m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#108274PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BEC enhancer-minBG-iCre(R279T)-4x6T
Plasmid#236727PurposeBrain Endothelial Cell Enhancer with 4x6T miRNA targeting cassette For use in combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors.DepositorInsertscis-regulatory elements 89763
iCre(R297T)
4x6T miRNA targeting cassette
UseAAVMutationR297TAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#78174PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the human synapsin promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterhuman synapsinAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP1347 - pAAV-AiE2E118m-minBGpromoter-SYFP2-WPRE3-bGHpA
Plasmid#208136PurposeDirect-expressing SYFP2 in astrocytes AAV Virus. Alias: AiP1347 - pAAV-AiE2118m-minBG-SYFP2-WPRE-BGHpADepositorInsertSYFP2
UseAAVMutationNAPromoterBeta Globin minimal promoterAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP1318 - pAAV-AiE2013m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230527PurposeAiE2013m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY017SB_pAAV-U6sg(BbsI)-EFS-Thy1.1-P2A-SB100X
Plasmid#192151PurposeT cell CRISPR AAV-SB vectorDepositorTypeEmpty backboneUseAAVExpressionMammalianMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA
Plasmid#107270PurposeExpresses Cas9 upon induction with doxicycline.DepositorInsertshSpCas9
rtTA
bGH polyA-SV40polyA
Tags3xFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCAG and TREAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Plasmid#92392Purposeproduces AAV expressing Cal-light TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTADepositorInsertTM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyExpressionMammalianPromoterHuman SynapsinAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV Syn-FLEX-coca-GlyR-IRES-mCherry
Plasmid#242196PurposeCre-dependent AAV vector for cocaine-gated chemogenetic anion channelDepositorInsertSyn-FLEX-coca-GlyR-IRES-mCherry
UseAAVExpressionMammalianMutationL141G G175K Y217FPromoterSynapsinAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4s-NGR-WPRE
Plasmid#234453PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1010-pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA
Plasmid#163476PurposeDirect-expressing iCre AAV Virus. Alias: AiP1010 - pAAV-AiE2004m-minBG-iCre-WPRE-HGHpADepositorInsertiCre
UseAAVPromoterBeta Globin minimal promoterAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS-GFP(ATG mut)
Plasmid#197885PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RAM-d2TTA::TRE-NLS-mKate2-WPREpA
Plasmid#84474PurposepAAV-RAM-NLS-mKate2DepositorInsertmKate2
UseAAVTagsNuclear localization signal of SV40 large T antig…PromoterTREAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gat1-HA-WPRE-HGHpA
Plasmid#184635PurposeExpresses the GABA membrane transporter Gat1 fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-JNKKTRrsGreenF-E-2A-ERKKTRrsFastLime-IRES-PKAKTRClover-2A-P38KTRDronpa
Plasmid#205766PurposeExpression of JNK KTR rsGreenF-E, ERK KTR rsFastLime, PKA KTR Clover, and P38 KTR Dronpa in mamalian cellsDepositorInsertJNK KTR rsGreenF-E-2A-ERK KTR rsFastLime-IRES-PKA KTR Clover-2A-P38 KTR Dronpa
UseAAVExpressionMammalianMutationwtAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1277 - pAAV-AiE2051m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214479PurposeAiE2051m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP
Plasmid#137140PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#50942PurposeBicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVPromoterhSyn1Available SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
AiP20010 - pAAV-AiE2356m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230554PurposeAiE2356m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1862 - pAAV-AiE2566m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214561PurposeAiE2566m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1316 - pAAV-AiE2010m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230526PurposeAiE2010m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gad67-WPRE-HGHpA
Plasmid#184632PurposeExpresses Gad67, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP1653 - pAAV-AiE2333m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214506PurposeAiE2333m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gad65-WPRE-HGHpA
Plasmid#184631PurposeExpresses Gad65, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131004Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of human Synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsKv2.1-HAPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP1858 - pAAV-AiE2538m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214558PurposeAiE2538m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only