We narrowed to 23,201 results for: ESC
-
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDM097
Plasmid#216819PurposeAspergillus nidulans codon-adjusted mStayGold fluorescent protein, includes linker for N-terminal or internal tagging.DepositorInsertmStayGold
TagsFLAG-(SGGS)x2-XTEN16-(GGGGS)x3 and c4-(GGGGS)x2-X…ExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
Plasmid#218766Purposeencodes EcTyrRS-VSMA* and EcTyr-tRNA-TAGDepositorInsertEcTyrRS-VSMA*
ExpressionBacterialMutationY37V, D167G, D182S, F183M, L186A, D265RPromotertacIAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21b-effector-ncRNA-rrt-His8
Plasmid#194089PurposeExpresses Ec86 operon (effector, ncRNA and reverse transcriptase) in Escherichia coliDepositorInsertEc86 effector-ncRNA-rrt
TagsHis8PromoterT7Available SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP8f L27A
Plasmid#204140PurposeFluorescent reporter for calcium imaging in mammalian cells - jGCaMP8f with L27A mutationDepositorInsertjGCaMP8f L27A
TagsN-terminal His tagExpressionMammalianMutationLeucine 27 changed to AlaninePromoterCMVAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
ExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_tKiMBImut-T2A-caMEK
Plasmid#199579PurposeExpress tKiMBImut(AA) and caMEK in an AAV vectorDepositorInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
constitutively active MEK
UseAAVExpressionMammalianPromoterCMVAvailable SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlmdCas12e VPR
Plasmid#188516PurposeExpresses FLAG tagged PlmdCas12e fused to VPR (VP64-p65-Rta)DepositorInsertdCas12e
UseCRISPR and LentiviralTagsNLS-FLAG-VPRExpressionMammalianMutationD659A/E756A/D922APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmRE-Tn5-142
Plasmid#118531PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmClover3
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FluoSTEP-AKAR (C/Y)
Plasmid#181862PurposeFluoSTEP-AKAR using split CFP and cpVenus(E172) as the FRET donor and acceptor. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-AKAR (C-Y)
TagsCFP(1-10) and cpVenus(E127)ExpressionMammalianPromoterCMVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPEE42
Plasmid#139421PurposeRecyclable marker for use in Cryptococcus neoformans. Contains the amdS2 counterselectable marker flanked by the Citrine ORF and a flexible linker at the 5' end.DepositorInsertCitrine
ExpressionYeastPromoterTEF1Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPEE45
Plasmid#139424PurposeRecyclable marker for use in Cryptococcus neoformans. Contains the amdS2 counterselectable marker flanked by the mTurquoise2 ORF and a flexible linker at the 5' end.DepositorInsertmTurquoise1
ExpressionYeastPromoterTEF1Available SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPEE44
Plasmid#139423PurposeRecyclable marker for use in Cryptococcus neoformans. Contains the amdS2 counterselectable marker flanked by the mTFP1 ORF and a flexible linker at the 5' end.DepositorInsertmTFP1
ExpressionYeastPromoterTEF1Available SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPEE43
Plasmid#139422PurposeRecyclable marker for use in Cryptococcus neoformans. Contains the amdS2 counterselectable marker flanked by the mMaroon1 ORF and a flexible linker at the 5' end.DepositorInsertmMaroon1
ExpressionYeastPromoterTEF1Available SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Antares-SEPLuc C1A4E
Plasmid#141088Purposeprecursor of the bioluminescent reporter pHluc, for detecting extracellular pH changes in tumor acidosis; utilizes weaker mutant of IRES and weaker precursor of NanolucDepositorInsertAntares-T2A-puromycin-IRESv24-SEP-C1A4E
ExpressionMammalianMutationPlease see depositor commentsPromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA- Pconstitutive-sgRNA(Sth3)_cpaA
Plasmid#133348Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets blaA and second one targets cpaA (from Caulobacter crescentus)DepositorInsertsgRNA_blaA and sgRNA_cpaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET15b-GreBdm-D41N
Plasmid#129691Purposeexpress E. coli GreB E82C/C68S/D41NDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only