We narrowed to 7,635 results for: PAC
-
Plasmid#166033PurposeExpression of 6X MS2 stem loops fused SpCas9 mRNA for packaging of SpCas9 mRNA within lentiviral particles.DepositorInsertSpCas9
UseCRISPR and LentiviralPromoterCMVAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATG9A-mCherry
Plasmid#197393PurposeExpresses ATG9A in mammalian cellsDepositorAvailable SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS hygro
Plasmid#158634PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS constructDepositorAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-3
Plasmid#218798PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-3
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-2
Plasmid#218797PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-2
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS
Plasmid#158628PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVSDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-4
Plasmid#218799PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-4
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas_4(I-U)/1_2_VB
Plasmid#186445PurposeEncodes Cas4/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B). Cas4 domain swapped with type U-I Cas4 domain from G. sulfurreducensDepositorInsertCas4/1 and Cas2
UseCRISPRMutationCas4 domain swapped with Cas4 domain from G. sulf…PromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS10-riboE-dddAI
Plasmid#186561PurposeRegulated expression of the DddA immunity determinant (DddAI) in FirmicutesDepositorInsertdddAI
ExpressionBacterialPromoterpSpac(hy)Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H163A H258A 3xFLAG-V5
Plasmid#174131PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H163A, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H258A 3xFlag-V5
Plasmid#174130PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Gln93
Plasmid#158629PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala148
Plasmid#158630PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28.His.3C.Tau2N4R
Plasmid#226396PurposeExpresses his-tagged, 3C-cleavable WT 2N4R tau for recombinant protein production in bacteriaDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaKKHABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SauriABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189925PurposeAAV genome encoding SauriABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSauriABE8e
UseAAVMutationSauriCas9 D15APromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-Tau2N4R-WPRE
Plasmid#226381PurposeExpresses tau propagation ORF with V5 tag on WT 2N4R tauDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only