We narrowed to 19,334 results for: Mut
-
Plasmid#60799PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains INSIG2 3' UTR and mutated miR-155 sitesDepositorInsertINSIG2 3'UTR and mutated miR-155 binding site (INSIG2 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mELOVL6
Plasmid#60791PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ELOVL6 3' UTR and mutated miR-155 sitesDepositorInsertELOVL6 3'UTR and mutated miR-155 binding site (ELOVL6 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TD)
Plasmid#61521PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TD mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TD mutation (see comments), Tom20, and m…ExpressionMammalianMutationTD mutation (see comments)PromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mLMBRD2
Plasmid#60801PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LMBRD2 3' UTR and mutated miR-155 sitesDepositorInsertLMBRD2 3'UTR and mutated miR-155 binding site (LMBRD2 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE3331
Plasmid#107536PurposeExpresses Fn crRNA and human codon optimized FnCpf1(RVR mutant) in mammalian cells.DepositorInsertsFn crRNA
hFnCpf1(RVR mutant)
Tags3xHA and NLSExpressionMammalianMutationN607R, K613V, N617RPromoterCMV and human U6Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CARMA2sh-E142G
Plasmid#97070PurposeExpresses Psoriasis-Linked mutant CARD14/CARMA2 in mammalian cellsDepositorInsertCARD14 isoform 3 (CARD14 Human)
TagsHAExpressionMammalianMutationchanged Glutamic Acid 142 to GlycinePromoterCMVAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K682A_K709A POLH
Plasmid#221864PurposeExpresses POLH mutated at K682A and K709A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A + K709A. Coding sequence has been opti…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K682A_K686A_K694A_K709A POLH
Plasmid#221865PurposeExpresses POLH mutated at K682A, K686A, K694A and K709A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A, K686A, K694A + K709A. Coding sequence…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-HK2 (D209A, D657A)-3xFLAG
Plasmid#239244PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterCMVAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(A5,8,12,16)-HaloTag-FRT
Plasmid#247455PurposeExpresses wild-type H4(A5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(A5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(Q5,8,12,16)-HaloTag-FRT
Plasmid#247454PurposeExpresses wild-type H4(Q5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(Q5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(R5,8,12,16)-HaloTag-FRT
Plasmid#247453PurposeExpresses wild-type H4(R5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(R5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_H0-ABD+
Plasmid#234554PurposeCTNNA1 M-domain deletion mutant with enhanced actin-binding domain mutationsDepositorAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)
Plasmid#215451PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF)DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
A1-LCD allW D262V
Plasmid#234616PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD allW D262N
Plasmid#234615PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262N with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262N (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-n'Cas9-BE4max
Plasmid#216730PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and n'Cas9 (Cas9 with H840A mutation) in mammalian cells.DepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only