We narrowed to 9,075 results for: sgRNA
-
Plasmid#64153PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only
-
hAAVS1-gs4_EF1a-Cas9-2A-GFP
Plasmid#118414PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA AAVS1 (AAVS1 Human)
UseCRISPRExpressionMammalianAvailable sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLEW100v5-BSD-T7-sgRNA
Plasmid#245119PurposePlasmid backbone to for inserting a T7 promoter driven guide RNA into the rDNA spacer of T. bruceiDepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable sinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PGC1a1 sgRNA
Plasmid#165425PurposeExpression of gRNA against human PGC-1a variant 1DepositorInsertgRNA against PGC-1a variant 1 (PPARGC1A Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTBL436 HEK293site3EQR sgRNA
Plasmid#126445PurposeTo cut the human HEK293 site3 locus for integration.DepositorInsertspacer against human HEK293 site3 with NGAG PAM
ExpressionMammalianPromoterhuman U6Available sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-mTZAP
Plasmid#87187PurposeguideRNA targeting exon2 of mouse TZAPDepositorAvailable sinceMarch 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgRNA(MS2)_Prnp_SAM2
Plasmid#78625PurposeEncodes sgRNA2.0 targeting 138nt upstream of TSSDepositorAvailable sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2)_Prnp_SAM1
Plasmid#78624PurposeEncodes sgRNA2.0 targeting 158nt upstream of TSSDepositorAvailable sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)
Plasmid#90086PurposeThis plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
VVT1
Plasmid#65779PurposeThe Joung Lab recommends using BPK2660 (Addgene plasmid 70709) instead of VVT1 as guide RNAs cloned into BPK2660 are more effective than this plasmid. Human expression plasmid for S. aureus Cas9 sgRNADepositorInsertSaCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9
Plasmid#135964PurposeExpresses SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable sinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJMP1337
Plasmid#119270Purposefor cloning new sgRNAsDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_Psyn-sgRNA500
Plasmid#149640Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only