We narrowed to 2,520 results for: gcg
-
Plasmid#170817PurposeLentiviral vector to co-express a human ITGB1 spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mNeonGreen-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
SRSF2 A9.3 gRNA
Plasmid#90902Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
SRSF2 A10.3 gRNA
Plasmid#90903Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
UNG D12.3 gRNA
Plasmid#90937Purpose3rd generation lentiviral gRNA plasmid targeting human UNGDepositorInsertUNG (Guide Designation D12.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_3
Plasmid#73535PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna7-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128342PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-5
Plasmid#109011PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CBX5 A1.5 gRNA
Plasmid#90570Purpose3rd generation lentiviral gRNA plasmid targeting human CBX5DepositorInsertCBX5 (Guide Designation A1.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
KMT5A H1.3 gRNA
Plasmid#90726Purpose3rd generation lentiviral gRNA plasmid targeting human KMT5ADepositorInsertKMT5A (Guide Designation H1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
HJURP E3.1 gRNA
Plasmid#90710Purpose3rd generation lentiviral gRNA plasmid targeting human HJURPDepositorInsertHJURP (Guide Designation E3.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-PrPro
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2260 hNOLC1 atgRNA Paired Guide 2
Plasmid#220990PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2262 hACTB atgRNA Paired Guide 2
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #1
Plasmid#198762Purposeconditional knockdown of PP1CDepositorInsertshPP1C #1 (PPP1CC Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA3_dTet_mTurquoise2
Plasmid#189806PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA3 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA2_dTet_mTurquoise2
Plasmid#189805PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA2 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v1-hu6-sgCebpb_v1
Plasmid#177251PurposeExpresses Cebpa_v1 (mU6), Cebpb_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v1-hu6-sgCebpd_v1
Plasmid#177253PurposeExpresses Cebpa_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpd_v1
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hU6-sgNT1 (opti)
Plasmid#177237PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses non-targeting gRNADepositorInsertsgNT1
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpb_v1 (opti)
Plasmid#177247PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpb gRNADepositorInsertsgCebpb_1st
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpd_v1 (opti)
Plasmid#177249PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpd gRNADepositorInsertsgCebpd_1st
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Grin1 gRNA#1
Plasmid#169789PurposeCas9-mediated knockout of Grin1 in mammalian cellsDepositorAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pW188-lenti-spsgRNA-lacZ-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170813PurposeLentiviral vector to co-express a lacZ control spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
MCM6 E2.2 gRNA
Plasmid#90763Purpose3rd generation lentiviral gRNA plasmid targeting human MCM6DepositorInsertMCM6 (Guide Designation E2.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only