We narrowed to 173,766 results for: Gene
-
Plasmid#46563PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (CMVwt CAAT box mutant).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-C18
Plasmid#46560PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (CMVwt CAAT box mutant).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL534
Plasmid#49940PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
SL535
Plasmid#49941PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL539
Plasmid#49948PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-6xHis-TFIIB-V5-BB
Plasmid#242714PurposeDoxycycline-inducible expression of double-tagged 6xHis-TFIIB-V5 (human). Construct is resistant to Dharmacon OnTarget and Accell GTF2B siRNA pools.DepositorInsertTranscription Factor IIB (GTF2B Human)
Tags6xHis and V5ExpressionMammalianMutationConstruct is resistant to Dharmacon Accell and On…PromoterTight TRE promoterAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV2.GL
Plasmid#242201PurposeAAV packaging plasmid expressing Rep/Cap genes for production of AAV2.GLDepositorInsertsAAV2 rep
AAV2.GL cap
UseAAVMutationreplaced R588 with AAAGLSPPTRAARAvailable SinceMay 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKG01416_TRE-TagBFP-bGH-EF1alpha-mRuby2-SV40
Plasmid#252541PurposeInducible gene and constitutive reporter with downstream tandem syntax, used to generate monoclonal PiggyBac-integrated linesDepositorInsertmRuby2
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), Tight TR…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKG01417_TRE-TagBFP-bGH-(EF1alpha-mRuby2-SV40)
Plasmid#252542PurposeInducible gene and constitutive reporter with convergent syntax, used to generate monoclonal PiggyBac-integrated linesDepositorInsertmRuby2
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), Tight TR…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKG03426_pLentiX1-EF1alpha-mRuby2-bGH-TRE-TagBFP-bGH
Plasmid#252550PurposeInducible gene and constitutive reporter with upstream tandem syntax, lentiviral vectorDepositorInsertmRuby2
UseLentiviralExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), TRE3GAvailable SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKG03425_pLentiX1-TRE-TagBFP-bGH-EF1alpha-mRuby2-bGH
Plasmid#252551PurposeInducible gene and constitutive reporter with downstream tandem syntax, lentiviral vectorDepositorInsertmRuby2
UseLentiviralExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), TRE3GAvailable SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKG03427_pLentiX1-EF1alpha-mRuby2-bGH-(TRE-TagBFP-bGH)
Plasmid#252552PurposeInducible gene and constitutive reporter with convergent syntax, lentiviral vectorDepositorInsertmRuby2
UseLentiviralExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), TRE3GAvailable SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMVp_eGFP
Plasmid#241002PurposeFor targeted gene knock-in at NHP IGH locus and constitutive expression of GFPDepositorAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pVH4p_eGFP
Plasmid#241003PurposeFor targeted gene knock-in at NHP IGH locus and B cell-specific expression of GFPDepositorAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-GFP-WPRE-miR124T
Plasmid#245069PurposeFluorescent reporter gene with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
Plasmid#247049PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous armDepositorInsertGlutathione S-Transferase Alpha 2 (Gsta2 Mouse)
ExpressionMammalianAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP979
Plasmid#239901PurposeCaMV 35S-SynPro-14 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-14::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only