We narrowed to 6,001 results for: plasmid dna
-
Plasmid#113354Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of ATP9A geneDepositorInsertATP9A-enhancer (ATP9A Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KMT2B
Plasmid#101070PurposeDonor vector for 3' FLAG tag of human KMT2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRDA_791
Plasmid#216079PurposeMinimal plasmid; contains only ori and ampR, destination vectorDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseDestinationExpressionBacterialAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZJQIBEBT003
Plasmid#140053PurposeThe pZJQIBEBT003 plasmid contains the coding sequence of eMutS-L157C-G233C gene which has the ability of error removal in the gene synthesis process.DepositorInserteMutS-L157C-G233C-CBM-EGFP
TagsHis-TagExpressionBacterialMutationL157C, G233CPromoterT7Available SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gLacZ.Cas9-T2A-GFP
Plasmid#170361PurposeNegative control plasmid used for Crispr/cas9 based disruption.DepositorInsertCas9-T2A-GFP
UseLentiviralPromoterU6Available SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_ARID4B
Plasmid#101072PurposeDonor vector for 3' FLAG tag of human ARID4BDepositorAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_RERE
Plasmid#101069PurposeDonor vector for 3' FLAG tag of human REREDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RERE_1
Plasmid#101073PurposeEncodes gRNA for 3' target of human REREDepositorInsertgRNA against RERE (RERE Human)
UseCRISPRAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-TAF1-A
Plasmid#247346PurposeExpresses SpCas9 and a sgRNA targeting the human TAF1-A loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_ETV2_Down-Tandem
Plasmid#241393PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of ETV2DepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA201
Plasmid#216026PurposeFragmid fragment: (Cas protein) firefly luciferaseDepositorHas ServiceCloning Grade DNAInsertFluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA349
Plasmid#216032PurposeFragmid fragment: (Cas protein) Renilla luciferaseDepositorHas ServiceCloning Grade DNAInsertRluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V222A RAD23B
Plasmid#201580PurposeExpresses a variant of human RAD23B containing mutation V222A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation V222AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F400A RAD23B
Plasmid#201581PurposeExpresses a variant of human RAD23B containing mutation F400A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation F400AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only