We narrowed to 3,389 results for: guide rna expression plasmid
-
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-RrA3F
Plasmid#138340PurposeMammalian expression plasmid for BE4-RrA3FDepositorInsertBE4-RrA3F
UseTagsBP-NLSExpressionMammalianMutationPromoterCMVAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-PpAPOBEC1
Plasmid#138349PurposeMammalian expression plasmid for BE4-PpABOBEC1DepositorInsertBE4-PpAPOBEC1
UseTagsBP-NLSExpressionMammalianMutationPromoterCMVAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLdCN
Plasmid#84290PurposeExpress gRNA and Cas9 in Leishmania with Neomycin resistanceDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaTagsExpressionMutationPromoterL. donovani ribosome RNA promoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLdCH
Plasmid#84291PurposeExpress gRNA and Cas9 in Leishmania with Hygromycin resistanceDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaTagsExpressionMutationPromoterL. donovani ribosome RNA promoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFD116
Plasmid#124769PurposepFD116 carries dcas9 controlled by an aTc-inducible Ptet promoter, a sgRNA controlled constitutively from PpflB S. aureus promoter to clone a guide between two BsaI sites and oriT on pLZ12 vectorDepositorInsertsPtet
dcas9
PpflB sgRNA BsaI
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.flex.H2B.RFP
Plasmid#170373PurposeNegative control guide, Cre-inducible plasmid expressing nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVTagsExpressionMutationPromoterhuman SynapsinAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-SsAPOBEC3B
Plasmid#138343PurposeMammalian expression plasmid for BE4-SsAPOBEC3BDepositorInsertBE4-SsAPOBEC3B
UseSynthetic BiologyTagsBP-NLSExpressionMutationPromoterCMVAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-AmAPOBEC1
Plasmid#138342PurposeMammalian expression plasmid for BE4-AmABOBEC1DepositorInsertBE4-AmAPOBEC1
UseSynthetic BiologyTagsBP-NLSExpressionMutationPromoterCMVAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-SsAPOBEC3B R54Q
Plasmid#138344PurposeMammalian expression plasmid for BE4-SsAPOBEC3B R54QDepositorInsertBE4-SsAPOBEC3B R54Q
UseSynthetic BiologyTagsBP-NLSExpressionMutationPromoterCMVAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-RrA3F F130L
Plasmid#138341PurposeMammalian expression plasmid for BE4-RrA3F F130LDepositorInsertBE4-RrA3F F130L
UseSynthetic BiologyTagsBP-NLSExpressionMutationPromoterCMVAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_1
Plasmid#155077PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only