We narrowed to 20,082 results for: ATO
-
Plasmid#106307PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-Tagged Clavesin1 (pCMV-Tag2B-Sec14a)
Plasmid#47430DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-Clavesin2 (pEGFP-C1-Sec14b)
Plasmid#47420DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHL417
Plasmid#62822PurposeLim Lab plasmid: AmpR + pLlacO-1::ompC::gfp::T1T2 terminator + PLtetO-1::micC::Asp terminator + pLtetO-1::RBS (st7) hfq::T1 terminator + ColE1DepositorInsertsgfp
micC leader
hfq leader
UseSynthetic BiologyTagsompC leader and st7 RBSExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
tdiRFP-BFP reporter
Plasmid#190184PurposeThe cre-activatable fluorescence reporterDepositorInsertstdiRFP
TagBFP2
ExpressionBacterial and MammalianPromoterCMVAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 HopU1
Plasmid#228395PurposepENTR4 plasmid with CDS of Pseudomonas syringae pv tomato type III effector HopU1 without stop codon for C-terminal epitope tagsDepositorInsertHopU1
UseGateway-compatible entry vectorMutationAlanine inserted after start Methionine due to Nc…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
mActA-mSspB-mCherry
Plasmid#210294PurposeActuAtor for iLID optogeneticsDepositorInsertmActA-,SspB-mCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol1 - 14xUAS:CaSR-EGFP
Plasmid#191502PurposeA UAS construct used to create transgenic fish that express CaSR-EGFP when crossed to a fish carrying a Gal4.DepositorInsertCaSR-EGFP-SV40
UseCreation of transgenic fish using tol1 transgenes…Promoter14X UASAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF149 shRNA-TRE
Plasmid#225337PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertRNF149 shRNA (Rnf149 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luciferase shRNA-TRE
Plasmid#225339PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertLuciferase shRNA (LOC116160065 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast coUCK2 D62A
Plasmid#211530PurposeExpresses codon optimized catalytic mutant UCK2DepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS9
Plasmid#218717PurposeExpresses N-terminally EGFP-tagged BBS9 in mammalian cellsDepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.Z-GS3
Plasmid#204758PurposeExpression of Cas9 and human H2A.ZDepositorInsertH2AZ1 (H2AZ1 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-IFT38
Plasmid#218723PurposeExpresses N-terminally EGFP-tagged IFT38 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-ctfR1
Plasmid#207992PurposeCRISPR vector used with pAf-CRISPR-phoA (#207991) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertctfR1
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only