We narrowed to 4,936 results for: AAT
-
Plasmid#184973PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v1
ExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5004_hU6_sgRNA targeting e7
Plasmid#190687PurposesgRNA targeting enhancer 7 of MYCDepositorInsertsgRNA targeting enhancer 7 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV152
Plasmid#188485PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV162
Plasmid#188486PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA3
Plasmid#172711PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_5-1
Plasmid#185054PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_3-2DepositorInsertTFAP4_5_1_gRNA (Tcfap4 Mouse)
UseLentiviralAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA5
Plasmid#180366Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA4
Plasmid#180365Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK15 pCAS-Tyr-[gRNA: 5=ARS308] (SplitKanR, AmpR)
Plasmid#178999PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLeGO.sgGata1.4.RUNX1A.iG2
Plasmid#181976Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)DepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV152
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only