We narrowed to 173,766 results for: Gene

#195038

pFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interference

Gloria Brar

Powers et al Elife. 2022 Dec 12;11:e81086. doi: 10.75

Feb. 9, 2023

Academic Institutions and Nonprofits only

#186414

AttR3/R4 destination vector for ascidian electroporation with AttB1/B2 recombined NLSLacZ under control of AttB4/B5-recombined pFOG ectodermal regulatory sequence.

Patrick Lemaire

Roure et al PLoS One. 2007. 2(9):e916.

Aug. 9, 2022

Academic Institutions and Nonprofits only

#163918

Contains bidirectional reporter genes dtomato and nuclear-targeting EGFP.

John Engelhardt

Choi et al Genes (Basel). 2020 Oct 6;11(10). pii: g

Feb. 11, 2021

Academic Institutions and Nonprofits only

#87390

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87388

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#165925

CRISPR-mediated gene perturbation (knock-out) of ACIN1

Vamsi Mootha

Alexis A. et al Molecular Cell

Academic Institutions and Nonprofits only

#165926

CRISPR-mediated gene perturbation (knock-out) of ACIN1

Vamsi Mootha

Alexis A. et al Molecular Cell

Academic Institutions and Nonprofits only

#165927

CRISPR-mediated gene perturbation (knock-out) of ENO1

Vamsi Mootha

Alexis A. et al Molecular Cell

Academic Institutions and Nonprofits only

#165928

CRISPR-mediated gene perturbation (knock-out) of ENO1

Vamsi Mootha

Alexis A. et al Molecular Cell

Academic Institutions and Nonprofits only

#165929

CRISPR-mediated gene perturbation (knock-out) of HK2

Vamsi Mootha

Alexis A. et al Molecular Cell

Academic Institutions and Nonprofits only