We narrowed to 7,455 results for: trac
-
Plasmid#166780PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma11-GFP2 (GNG11 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
(attB) tdMCP-tagged BRaf with MS2-circRNA
Plasmid#226163PurposeUsed to integrate 3xFlag-tdMCP-BRaf and MS2-circRNA barcodes into RNA-Protein Landing Pad cell linesDepositorInsertsUseBxb1 attb, no promoterTags3xFlag-tdMCPExpressionMammalianAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
InsRA-eGFP
Plasmid#79795PurposeInsulin receptor isoform A with a inter-domain eGFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
5` CC: Puro – loxP – GFP-C
Plasmid#219563Purpose5` circularization cassette.Used in combination with one of the 3' circularization cassettes to induce Cre-mediated circularizazion or inversion of a desired genomic region.DepositorInserthPGK-promoter_PuroR_2A_loxP_GFP-C
UseUnspecifiedPromoterhPGKAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – GFP-N – loxP – mScarlet
Plasmid#219564Purpose3` circularization cassette.To induce Cre-mediated circularization or inversion of a genomic region with concomitant GFP reconstitution and mScarlet expression from the chromosomeDepositorInsert3` CC: Hygro – GFP-N – loxP – mScarlet
UseUnspecifiedPromoterEF1-aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma9-GFP2
Plasmid#140991PurposeEncodes a G gamma subunit (GNG9) containing GFP2 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
UPRT-mCh-Nluc-P2A-neo-UPRT
Plasmid#135015PurposeExpresses mCherry protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum UPRT locusDepositorInsertsmCh-Nluc-P2A-neo
UPRT 5'UTR
UPRT 3'UTR
UseCryptosporidium expressionTagsmCherry and Nluc-neoPromoterCryptosporidium actin and enolaseAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1 GBP (GBP-mCherry)
Plasmid#162879PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with mCherryDepositorInsertGFP Binding Protein
TagsmCherryExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1-GGamma13-GFP2
Plasmid#140992PurposeEncodes a G gamma subunit (GNG13) containing GFP2 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FRT-stop-FRT(FSF)- loxP-stop-loxP(LSL)-SP-HA-HRPtm-WPRE-bGHpolyA
Plasmid#197044PurposeIn situ cell-surface proteome extraction by extracellular labeling (iPEEL)DepositorInsertspCAG-FSF-LSL
SP-HA-HRPtm
WPRE-bGHpolyA
TagsHA, mycExpressionMammalianPromoterpCAGAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-IDH1-FLAG
Plasmid#66802PurposeTet-inducible expression of IDH1 in mammalian cells, 3rd generation lentiviral vectorDepositorAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Cas9-T2A-TdT
Plasmid#126424PurposeExpresses Cas9-T2A-TdT in mammalian cells. (pTBL209)DepositorAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-ACE2
Plasmid#141185PurposeMammalian expression plasmid for human ACE2 with an N-terminal (extracellular) c-myc tagDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H326
Plasmid#228242PurposemT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only