We narrowed to 3,581 results for: TIL
-
Plasmid#169530PurposeTier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "fast" maturation fastFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).DepositorInsertPCMV-driven P2A-fused fluorescent timer, fast maturation time
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2361_Tier3(SB)-rtTA-YPet_PuroR
Plasmid#169657PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH663
Plasmid#169607PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven tTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-tTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven tTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH614
Plasmid#169603PurposeTier-2 vector encoding PmPGK1-driven Fluc and PCREm4-driven Nluc expression (PmPGK1-Fluc-pA::PCREm4-Nluc-pA::A3-pA).DepositorInsertPPGK-driven FLuc Luciferase expression cassette and cAMP response element-controlled NanoLuc Luciferase expression cassette
ExpressionMammalianPromoterPCREm4 / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH265-Tier1-OTetO7-PCMVmin2-TS-SEAP
Plasmid#169588PurposeTier-1 vector encoding PTetO7-driven SEAP expression with a suppressor 5'UTR (OTetO7-PCMVmin-2-5'UTRTS-SEAP-pA).DepositorInserttetracycline-controlled SEAP expression
ExpressionMammalianPromoterTetO7-PCMVmin-2Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH255-Tier1-OTetO7-PCMVmin1-SEAP
Plasmid#169587PurposeTier-1 vector encoding PTetO7-driven SEAP expression (OTetO7-PCMVmin-1-SEAP-pA).DepositorInserttetracycline-controlled SEAP expression
ExpressionMammalianPromoterTetO7-PCMVmin-1Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH229-Tier1-OTtgO2-PCMVmin2-SEAP
Plasmid#169565PurposeTier-1 vector encoding PTtgO2-driven SEAP expression (OTtgO2-PCMVmin-2-SEAP-pA).DepositorInsertphloretin-controlled SEAP expression
ExpressionMammalianPromoterTtgO2-PCMVminAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2392-Tier1-PhCMV-p2a_medFT
Plasmid#169529PurposeTier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "medium" maturation medFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).DepositorInsertPCMV-driven P2A-fused fluorescent timer, medium maturation time
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2388-Tier1-PhCMV-p2a_Ypet
Plasmid#169525PurposeTier-1 vector encoding PhCMV-driven yellow fluorescent protein YPet fused to a "self-cleaving" peptide p2a (PhCMV-p2a_YPet-pA).DepositorInsertPCMV-driven P2A-fused yellow fluorescent protein Ypet
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2389-Tier1-PhCMV-p2a_mRuby
Plasmid#169526PurposeTier-1 vector encoding PhCMV-driven red fluorescent protein mRuby2 fused to a "self-cleaving" peptide p2a (PhCMV-p2a_mRuby2-pA).DepositorInsertPCMV-driven P2A-fused enhanced yellow fluorescent protein
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2363_Tier3(PB)-rtTA-YPet_PuroR
Plasmid#169659PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2405-Tier1-PhCMV-TEV
Plasmid#169500PurposeTier-1 vector encoding PhCMV-driven tabacco etch virus protease TEV (PhCMV-TEV-pA).DepositorInsertPCMV-driven tobacco etch virus protease
ExpressionMammalianPromoterPhCMVAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
D19_Ld_130940
Plasmid#135835PurposeExpression of Leishmania donovani ectodomain in mammalian cellsDepositorInsertsubtilisin-like serine peptidase,serine peptidase, clan SB, family S8-like protein
Tagsbiotinylation sequence and His tagExpressionMammalianAvailable SinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_R89A-PolyA
Plasmid#112291PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) R89A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Arginine 89 to AlaninePromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_L91A-PolyA
Plasmid#112292PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) L91A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Leucine 91 to AlaninePromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only